Compartilhar
Informação da revista
Vol. 87. Núm. 5.
Páginas 591-600 (Setembro - Outubro 2021)
Compartilhar
Compartilhar
Baixar PDF
Mais opções do artigo
Visitas
...
Vol. 87. Núm. 5.
Páginas 591-600 (Setembro - Outubro 2021)
Artigo original
Open Access
MicroRNA‐223‐3p regula a inflamação alérgica tendo como alvo o gene INPP4A
Visitas
...
Yong Zhoua,b,a, Ting Zhanga,b,1, Yongbing Yana,b, Bo Youa,b, Yiwen Youa,b, Wei Zhanga,b,
Autor para correspondência
tdfyzw@163.com

Autor para correspondência.
, Jing Chena,b,
Autor para correspondência
chenjing0408@hotmail.com

Autor para correspondência.
a Affiliated Hospital of Nantong University, Institute of Otolaryngology Head and Neck Surgery, Nantong, China
b Affiliated Hospital of Nantong University, Department of Otolaryngology Head and Neck Surgery, Nantong, China
Informação do artigo
Resume
Texto Completo
Bibliografia
Baixar PDF
Estatísticas
Figuras (7)
Mostrar maisMostrar menos
Tabelas (2)
Tabela 1. Características clínicas de controles saudáveis e pacientes com rinite alérgica
Tabela 2. Sequências de primers usadas na PCR quantitativa
Mostrar maisMostrar menos
Resumo
Introdução

Evidências emergentes indicam que as condições fisiológicas e patológicas do nariz são reguladas pós‐transcripcionalmente por microRNAs, uma classe de pequenos RNAs não codificantes. Recentemente, o microRNA‐223‐3p tem sido cada vez mais implicado na modulação da rinite alérgica.

Objetivo

Avaliar o papel e o mecanismo do microRNA‐223‐3p em um modelo de rinite alérgica em camundongos.

Método

O nível de expressão do microRNA‐223‐3p foi medido no soro de 41 pacientes com rinite alérgica e 39 controles saudáveis com polimerase chain reaction quantitativo em tempo real. Camundongos BALB/c foram usados para estabelecer um modelo de rinite alérgica através de sensibilização intraperitoneal e teste de provocação nasal com ovalbumina. O microRNA‐223‐3p agomir/antagomir foi então administrado por via intranasal a camundongos após provocação com ovabulmina por mais uma semana. Os sintomas de prurido nasal e espirros foram registrados. A concentração sérica de imunoglobulina E específica para ovalbumina, expressão de microRNA‐223‐3p e níveis de citocinas pró‐inflamatórias (IL‐4, IL‐5, IFN‐γ) na mucosa nasal foram medidos por ELISA e polimerase chain reaction quantitativo, respectivamente. As alterações histopatológicas foram avaliadas com coloração com hematoxilina e eosina.

Resultados

Os níveis de microRNA‐223‐3p aumentaram significativamente em ambos os pacientes e camundongos com rinite alérgica. Além disso, a suprarregulação dos níveis de microRNA‐223‐3p através da administração nasal de microRNA‐223‐3p agomir também aumentou significativamente a concentração de IgE específica para ovalbumina, as frequências de prurido nasal e espirros, os níveis de citocinas pró‐inflamatórias (IL‐4, IL‐5, IFN‐γ) e infiltração de eosinófilos na mucosa nasal de camundongos com rinite alérgica. Além disso, o microRNA‐223‐3p antagomir pareceu melhorar significativamente os sintomas e a doença da mucosa nasal. Posteriormente, demonstramos pela primeira vez que o microRNA‐223‐3p regulou negativamente a expressão de INPP4A ao se ligar à região 3’ não traduzida (3′UTR) do gene INPP4A.

Conclusões

Esses achados indicam que o microRNA‐223‐3p desempenha um papel importante na regulação da doença e dos sintomas da rinite alérgica, tem como alvo o gene INPP4A.

Palavras‐chave:
Rinite alérgica
Inflamação alérgica
MicroRNA‐223‐3p
INPP4A
Texto Completo
Introdução

Em alguns indivíduos com predisposição genética, fatores como alérgenos, infecções e poluição podem desencadear respostas imunes anormais, o que resulta em doenças alérgicas das vias aéreas, como a rinite alérgica (RA).1 Acredita‐se que a RA seja uma resposta imune mediada por IgE específica para alérgenos e é caracterizada pelo aumento da produção de citocinas T‐helper 2 (Th2), infiltração excessiva de eosinófilos e secreção de muco.2,3 Entre as doenças mais comuns em todo o mundo, a RA causa inflamação não infecciosa da mucosa nasal e hipersensibilidade. Brozek et al. relataram que a prevalência de RA autorreferida foi de aproximadamente 2% a 25% em crianças e a taxa confirmada de RA em adultos na Europa variou de 17% a 28,5%.4 As principais manifestações clínicas da RA incluem rinorreia, prurido, espirros e congestão nasal, que podem causar distúrbios do sono e diminuição da atenção, afetam gravemente a qualidade de vida, o desempenho escolar e laboral dos pacientes.5,6 Além disso, a RA é a base de muitas complicações, como sinusite, pólipos nasais, conjuntivite alérgica, faringite, otite média, traqueíte, bronquite e asma.7 Estima‐se que a asma ocorra em 15% a 38% dos pacientes com RA e a RA é um fator de risco para asma. Além disso, a RA, moderada a grave, não controlada, afeta o controle da asma.4 Os custos médicos causados pela asma são substanciais e os custos indiretos associados à baixa produtividade são ainda mais extensos. Dados publicados revelaram que a incidência de RA tem crescido rapidamente nas últimas décadas.4

O mecanismo subjacente à ocorrência de RA é complicado. Nas últimas décadas, considerou‐se geralmente que a RA é a consequência patológica da ativação e infiltração de mastócitos, eosinófilos e basófilos, respostas imunes inadequadas ou exageradas do tipo 2 e a geração e liberação de vários mediadores inflamatórios.8 Sua principal terapia clínica consiste no controle da doença com anti‐histamínicos, antagonistas dos receptores de leucotrienos, estabilizadores de mastócitos, imunoterapia específica para alérgenos, corticosteroides intranasais e descongestionantes.9

Infelizmente, os mecanismos moleculares que mediam a RA permanecem obscuros. Embora os medicamentos acima aliviem os sintomas na maioria dos pacientes, eles não curam a doença. Além disso, 20% dos pacientes com RA que recebem tratamento já apresentam melhoria subjetiva e objetiva insuficiente.10 Vale ressaltar que a imunoterapia ainda se limita a pacientes com RA específica a alergia ao ácaro. Mesmo que funcione, a possibilidade de recorrência ainda existe. Além disso, nem todos os participantes terminam todo o curso do tratamento. Portanto, é urgentemente necessário entender melhor a patogênese da RA e desenvolver novos tratamentos seguros que possam resolver a doença.

Os microRNAs (miRNAs), conhecidos como moléculas reguladoras críticas, são uma grande classe de moléculas de RNA não codificadoras, curtas, de cadeia única e altamente conservadas, com 19 a 25 nucleotídeos de comprimento codificado por genes endógenos.11 Eles podem induzir o silenciamento pós‐transcricional de genes, ligam‐se à região 3’ não traduzida (3′UTR) de seus RNAs mensageiros (mRNAs)‐alvo, resultam em degradação do mRNA ou repressão translacional.12 Além disso, um único miRNA pode ter milhares de alvos potenciais ao ligar‐se aos seus mRNAs‐alvo através de sequências complementares de 6 a 8 nucleotídeos de comprimento.11,13 Além disso, devido à sua alta estabilidade e vida útil relativamente longa, os miRNAs são ótimos biomarcadores de doenças.14,15 Produzidos por uma variedade de células, os miRNAs podem ser secretados em fluidos corporais e desempenhar um papel fundamental em uma ampla variedade de funções principais na maioria das células, como o ciclo celular, proliferação, diferenciação, apoptose e resposta imune, através da regulação de múltiplos genes‐alvo.12,16,17 Estudos recentes mostraram que miRNAs são cruciais na patogênese de doenças imunológicas e inflamatórias, inclusive a RA.18,19

Especificamente, evidências crescentes sugerem que o microRNA‐223‐3p (miR‐223‐3p) pode estar envolvido na inflamação alérgica, uma importante manifestação da patogênese da RA.18,20 Portanto, neste estudo, investigamos se e como o miR‐223‐3p regula a inflamação alérgica, estabelece um modelo de RA em camundongos. Nosso objetivo foi determinar o nível de expressão do miR‐223‐3p na RA e os mecanismos moleculares subjacentes dessa doença in vivo. Dessa forma, propomos uma potencial opção terapêutica.

MétodoAmostras de RA humanas e Declaração de Ética

Quarenta e um pacientes com RA e 39 indivíduos saudáveis foram incluídos no atual estudo. A RA foi diagnosticada de acordo com as diretrizes ARIA (Allergic Rhinitis and its Impact on Asthma), revisão de 2016, após a confirmação do histórico da doença, sintomas nasais, exame clínico e teste cutâneo (skin prick test).4 Os indivíduos controles saudáveis não apresentavam doenças nasais ou histórico de asma. Os detalhes das características dos indivíduos estão incluídos na tabela 1. As amostras de sangue periférico coletadas dos participantes foram imediatamente centrifugadas para isolar o soro, a partir do qual o RNA total foi extraído para ser submetido a PCR em tempo real. O estudo foi aprovado pelo comitê de ética de nossa instituição e o consentimento informado por escrito foi obtido de todos os participantes (Número da Pesquisa: 2019‐L062).

Tabela 1.

Características clínicas de controles saudáveis e pacientes com rinite alérgica

Característica  RA  Controle saudável 
Caso (n°)  41  39 
Sexo (masculino/feminino)  25/16  21/18 
Idade (anos)  15,9±21,2  16,5±20,5 
Duração (anos)  2,7±1,2  ‐ 
História de asma (%)  4,9%  ‐ 
História familiar (Sim/Não)  2/39  ‐ 
História de alergia alimentar (Sim/Não)  5/36  ‐ 
Escore INSS     
Rinorreia nasal  2,5±0,7  ‐ 
Prurido nasal  2,3±0,4  ‐ 
Espirros  2,2±0,6  ‐ 
Congestão nasal  2,1±0,7  ‐ 
Escore TNSS  8,5±1,2  ‐ 

INSS, Escore de Sintoma Nasal Individual (Individual Nasal Symptom Score); TNSS, Escore Total de Sintomas Nasais (Total Nasal Symptom Score).

Animais

Trinta camundongos BALB/c de 8 semanas de idade foram obtidos do centro experimental de animais de nossa universidade e alojados em uma instalação de contenção de risco biológico livre de patógenos específicos, mantidos em um ciclo de 12 horas escuro /claro e em temperatura ambiente de 20°±1° C, com acesso livre a comida e água. Todas as experiências com animais feitas neste estudo seguiram as Diretrizes do NIH e foram aprovadas pelo comitê de administração de animais experimentais de nossa instituição (número de pesquisa: 20180529‐001).

Modelo de produção de RA

Os camundongos foram divididos em seis grupos: controle, RA (camundongos com RA tratados com PBS), agomir mismatched (camundongos com RA tratados com agomir mismatched), miR‐223‐3p agomir (camundongos com RA tratados com miR‐223‐3p agomir), antagomir mismatched (camundongos com RA tratados com antagomir mismatched) e miR‐223‐3p antagomir (camundongos com RA tratados com miR‐223‐ 3p antagomir). O modelo de RA foi induzido de acordo com o protocolo resumido na figura 1.21 Em resumo, os camundongos foram sensibilizados com injeção intraperitoneal de 200μL de solução salina com 25μg de ovalbumina (OVA; grau V; Sigma‐Aldrich, St. Louis, MO, EUA) e 2mg de hidróxido de alumínio em gel nos dias 1, 7 e 14 Uma semana após a sensibilização primária, 3% de OVA diluídos em 20μL de solução salina foram pingados nas cavidades nasais dos camundongos diariamente, do dia 21 ao dia 27, para imunização secundária. Para o grupo controle (normal), apenas solução salina foi administrada na injeção intraperitoneal e teste provocativo intranasal do começo ao fim.

Figura 1.

Diagrama esquemático do experimento animal. Camundongos BALB/c foram injetados intraperitonealmente com ovalbumina (OVA) e hidróxido de alumínio (alúmen) nos dias 1, 7 e 14 para promover a sensibilização primária. Uma semana após a injeção intraperitoneal final, os camundongos foram submetidos a provocação intranasal com OVA por uma semana para induzir a imunização secundária, seguida de tratamento intranasal com agomir mismatched/miR‐223‐3p agomir/mismatched antagomir/miR‐223‐3p antagomir diariamente até 3h depois de cada provocação com OVA por 7 dias.

(0,1MB).
Tratamento com administração intranasal de MiR‐223‐3p agomir ou antagomir

MiR‐223‐3p agomir, miR‐223‐3p antagomir, agomir mismatched e antagomir mismatched foram sintetizados na RiboBio Company (Guangzhou, China). Como mostrado na figura 1, os camundongos foram tratados com uma administração intranasal de 5 pmoL/μL de miR‐223‐3p agomir ou miR‐223‐3p antagomir diluído em 20μL de solução salina até 3 horas depois do teste provocativo com OVA diariamente nos dias 28 a 34. Os grupos agomir mismatched/antagomir mismatched receberam por via intranasal 5 pmoL/μL de agomir/antagomir mismatched diluído em 20μL de solução salina, enquanto o grupo controle foi tratado apenas com solução salina.

Escore de sintomas

Cinco minutos após o teste provocativo final com OVA no dia 22, as frequências de espirros e prurido nasal foram registradas por um observador cego duas vezes em intervalos de 15 minutos.21,22 Os escores foram calculados da seguinte forma: 1 ‐ esfrega repetidamente o nariz ou espirra menos de 3 vezes; 2 ‐ esfrega repetidamente o nariz ou espirra entre 3 e 10 vezes; e 3 ‐ esfrega o nariz e a face com gravidade ou espirra mais de 11 vezes. Os camundongos com escores maiores do que 4 foram tratados posteriormente.

Preparação de amostras de tecido

Os camundongos foram sacrificados 24 horas após o teste provocativo intranasal final. Para a RT‐PCR, a mucosa nasal dos camundongos foi obtida, imediatamente imersa em nitrogênio líquido e armazenada a ‐80° C até o uso. Para as análises histológicas, as cabeças dos camundongos foram removidas e fixadas em paraformaldeído a 4% por 24 horas a 4°C. Os tecidos nasais dos camundongos foram descalcificados, desidratados em concentrações crescentes de etanol e depois embebidos em parafina.

Análise por RT‐PCR quantitativa em tempo real (qRT‐PCR)

O RNA total foi extraído das células ou dos tecidos da mucosa nasal dos camundongos com reagente TRIzol (Invitrogen, Carlsbad, CA, EUA) e então a concentração e a pureza do RNA foram determinadas. O miRNA sérico foi isolado com o kit de isolamento miRcute soro/plasma miRNA (Tiangen Biotech, Pequim, China) de acordo com as instruções do fabricante. Dois microgramas de RNA foram transcritos reversamente para cDNA e a qRT‐PCR foi feita de acordo com as instruções para o Power SYBR Green PCR Master Mix (Applied Biosystems, EUA). Os primers específicos do gene alvo estão listados na tabela 2. As condições de reação para qRT‐PCR foram as seguintes: pré‐desnaturação a 95° C por 10min, seguida de 40 ciclos de amplificação a 95° C por 20s, reação de annealing a 62°C por 30s e extensão a 72° C por 30s. Para a qualificação do nível de expressão do miR‐223‐3p, o controle de pico sintético cel‐miR‐39 foi usado como controle invariável para o miRNA sérico, enquanto U6 serviu como referência interna correspondente para o miRNA celular. Os níveis médios de transcrição de IL‐4, IL‐5 e IFN‐γ na mucosa nasal e INPP4A celular foram normalizados para os níveis de GAPDH. Os dados foram calculados com o método 2‐ΔΔCT.

Tabela 2.

Sequências de primers usadas na PCR quantitativa

Genes    Sequências de primers (5’ a 3’) 
miR‐223‐3p  ‐  UGUCAGUUUGUCAAAUACCCCA 
IL‐4  Forward  CAAACGTCCTCACAGCAACG 
  Reverse  AGGCATCGAAAAGCCCGAAA 
IL‐5  Forward  AAATTCCTGTAGCGCAGGCT 
  Reverse  ACCCTGATGCAACGAAGAGG 
IFN‐γ  Forward  AGCCTCAGGAAGCGGAAAAG 
  Reverse  CTCATTGAATGCTTGGCGCT 
INPP4A  Forward  AAAGTGTGGCTGAACGTGGA 
  Reverse  GCTGTCCGGGTTACCTTTCT 
GAPDH  Forward  GGTTGTCTCCTGCGACTTCA 
  Reverse  CCCTAGGCCCCTCCTGTTAT 
U6  Forward  CGCTTCGGCAGCACATATACTAAAATTGGAAC 
  Reverse  GCTTCACGAATTTGCGTGTCATCCTTGC 
Cultura de células e transfecção de miRNA

Adquirimos células HEK293T do Cell Bank of Chinese Academy of Medical Science (Xangai, China), que foram mantidas em meio RPMI‐1640 com 10% de FBS, 100 U/mL de penicilina e 100 U/mL de estreptomicina (Invitrogen) em uma incubadora umidificada com 5% de CO2 a 37°C. Nos diferentes grupos, a transfecção foi feita com miR‐223‐3p agomir ou antagomir ou seus controles negativos correspondentes (GeneChem, Xangai, China) diluídos em meio Opti‐MEM I (Invitrogen) e transfectados para células HEK293T com Lipofectamine 2000 (Invitrogen) de acordo com as instruções do fabricante.

Medidas quantitativas de imunoglobulina E (IgE) específica para OVA

Para avaliar reações alérgicas, os níveis séricos de IgE específica para OVA foram medidos com kits ELISA de fase sólida (Cusabio, Wuhan, China). Os procedimentos foram feitos de acordo com as instruções do fabricante. Resumidamente, amostras de soro foram colhidas de camundongos no momento da morte e depois pipetadas em placas de 96 poços pré‐revestidas com mAb de IgE anti‐camundongo purificado. Adicionou‐se às placas a peroxidase de rábano (HRP) conjugada com IgE anti‐camundongo. As reações foram desenvolvidas com 3,3′, 5,5′‐tetrametilbenzidina e terminadas pela adição de H2SO4. A densidade óptica (DO) foi registrada por um luminômetro ajustado a 450nm.

Análises histológicas

Para a avaliação da histologia nasal, cortes coronais de aproximadamente 4μm de espessura foram obtidos do vestíbulo nasal e corados com hematoxilina e eosina (H&E). O número de eosinófilos na mucosa nasal foi contado sob um microscópio óptico (aumento de 400 ×).

Análise estatística

Todos os dados foram analisados com o software GraphPad Prism (versão 8.3; GraphPad Software, Inc., La Jolla, CA, EUA) e são expressos como média±desvio‐padrão (DP). As correlações entre os quatro grupos foram calculadas com a análise de variância unidirecional seguida pelos testes post hoc de comparação múltipla de Tukey; um valor de p <0,05 foi considerado estatisticamente significante.

ResultadosAumento da expressão de miR‐223‐3p no soro de pacientes com RA

As principais características clínicas de controles saudáveis e pacientes com RA são mostradas na tabela 1. Em nossos resultados, o nível de expressão de miR‐223‐3p no soro de pacientes com RA foi significantemente maior do que em indivíduos saudáveis (fig. 2A). As curvas ROC (receiver operating characteristic) foram geradas para a expressão de miR‐223‐3p e a sensibilidade e especificidade foram calculadas com base nas curvas ROC. A sensibilidade e a especificidade do miR‐223‐3p sérico foram determinadas através da construção de uma curva ROC com uma área rea sob a curva (AUC) de 0,845, revelou um poder diagnóstico relativamente alto na diferenciação entre pacientes com RA e controles saudáveis (fig. 2B). Esses resultados sugerem coletivamente que o miR‐223‐3p pode ser um potencial regulador positivo dos fatores pró‐alérgicos da RA e um biomarcador clínico promissor em pacientes com RA.

Figura 2.

O miR‐223‐3p é altamente expresso e serve como um biomarcador clínico em pacientes com RA. (A) O nível de expressão de miR‐223‐3p em pacientes com RA (n=41) foi significativamente maior do que em participantes saudáveis (n=39). (B) Análise da curva ROC do diagnóstico de RA para o marcador miR‐223‐3p. AUC: área sob a curva. A significância estatística foi avaliada com o teste t de Student bicaudal. A barra de erro indica o DP. (**** p <0,0001).

(0,08MB).
Expressão diferencial do miR‐223‐3p na mucosa nasal de camundongos com RA

Para investigar os efeitos do miR‐223‐3p na resposta alérgica na RA, o miR‐223‐3p foi superexpresso ou down‐regulado na mucosa nasal de camundongos com RA através da administração intranasal de miR‐223‐3p agomir ou miR‐223‐3p antagomir. Como mostrado na figura 3, a expressão de miR‐223‐3p estava significativamente elevada em camundongos com RA em comparação com o grupo controle e até aumentou ligeiramente em camundongos com RA tratados com miR‐223‐3p agomir. Por outro lado, a expressão de miR‐223‐3p foi muito menor em camundongos após administração nasal de miR‐223‐3p antagomir do que em camundongos com RA. Esses resultados sugerem que o miR‐223‐3p pode facilitar a RA e fornecer evidências de transdução genética bem‐sucedida nesses camundongos.

Figura 3.

Expressão de miR‐223‐3p na mucosa nasal de camundongos com RA após administração intranasal de agomir mismatched/miR‐223‐3p agomir/mismatched antagomir/miR‐223‐3p antagomir. Os camundongos com RA foram induzidos como descrito em um protocolo publicado anteriormente e, em seguida, tratados intranasalmente com agomir mismatched/miR‐223‐3p agomir/mismatched antagomir/miR‐223‐3p antagomir após a última provocação com OVA por uma semana. A expressão de miR‐223‐3p na mucosa nasal foi determinada por qRT‐PCR. (** p <0,01, **** p <0,0001).

(0,08MB).
Expressão de IgE específica para OVA e sintomas alérgicos em camundongos com RA

Também avaliamos os efeitos do miR‐223‐3p na resposta alérgica em camundongos com RA, medimos IgE específica para OVA no soro desses camundongos. A concentração de IgE específica para OVA aumentou significativamente em camundongos com RA em comparação com camundongos normais (fig. 4A). Além disso, a up‐regulação dos níveis de miR‐223‐3p através da administração intranasal de miR‐223‐3p agomir aumentou a concentração de IgE específica para OVA, que foi muito menor no grupo tratado com miR‐223‐3p antagomir (fig. 4 B‐C). Além disso, os sintomas alérgicos nasais, inclusive as ocorrências de prurido nasal e espirros, foram contados 30 minutos após o último teste provocativo com OVA no dia 34. Como mostrado na figura 4D, o escore dos sintomas aumentou acentuadamente em camundongos com RA comparados com camundongos normais e até se tornou significantemente maior nos camundongos com RA tratados com miR‐223‐3p agomir. O escore dos sintomas pareceu diminuir nos camundongos tratados com miR‐223‐3p antagomir.

Figura 4.

Efeitos do miR‐223‐3p na IgE específica da OVA e sintomas alérgicos em camundongos com RA. (A) Os valores de DO da IgE específica para OVA no soro dos grupos controle e RA foram medidos com ELISA. (B) Os valores de DO da IgE específica para OVA no soro dos grupos agomir mismatched e agomir miR‐223‐3p foram medidos com ELISA. (C) Os valores de DO da IgE específica para OVA no soro dos grupos antagomir mismatched e miR‐223‐3p antagomir foram medidos com ELISA. (D) Os escores de sintomas dos três grupos acima foram calculados. A barra de erro indica o DP. (*p <0,05, **p <0,01, ***p <0,001).

(0,22MB).
A up‐regulação do miR‐223‐3p aumenta os níveis de citocinas nos ratos com RA

Um estudo anterior relatou que a administração intranasal do antígeno da OVA poderia induzir uma resposta linfocitária Th2 na mucosa nasal, que gerou IL‐5 através da ativação de células linfoides inatas.23 Assim, investigamos a seguir se a up‐regulação do miR‐223‐3p aumenta a imunidade Th2 à OVA in vivo. Não é de se surpreender que os tecidos da mucosa nasal de camundongos com RA produzam níveis mais altos de citocinas Th2 (IL‐4, IL‐5) e citocinas Th1 (IFN‐γ). Além disso, todos esses níveis de citocinas aumentaram em camundongos com RA tratados com miR‐223‐3p agomir em comparação com camundongos com RA não tratados (figs. 5A‐B, D‐E, G‐H). Os níveis de expressão do mRNA de IL‐4, IL‐5 e IFN‐γ foram atenuados pela administração do miR‐223‐3p antagomir (figs. 5C, F e I).

Figura 5.

MiR‐223‐3p aumenta os níveis de citocinas em camundongos com RA. Os níveis de expressão de mRNA de IL‐4 (A ‐ C), IL‐5 (D ‐ F) e IFN‐γ (G ‐ I) foram detectados por qRT‐PCR. A significância estatística foi avaliada com o teste t de Student bicaudal. A barra de erro indica o DP. (* p <0,05, ** p <0,01, **** p <0,0001).

(0,42MB).
Promovendo o efeito do miR‐223‐3p na infiltração de células inflamatórias nos tecidos da mucosa nasal

Para a confirmação adicional do efeito do miR‐223‐3p nas alterações patológicas na mucosa nasal de camundongos com RA, as seções de tecido embebidas em parafina foram examinadas com a coloração H&E. Consistente com os resultados acima, a sensibilização por OVA induziu aparentes alterações patológicas no epitélio da mucosa nasal. Pior hiperemia, edema e estrutura caótica foram encontrados no epitélio da mucosa nasal de camundongos com RA do que em camundongos controle normais (fig. 6 A‐B). Além disso, todas essas alterações patológicas foram agravadas após a administração de miR‐223‐3p agomir (fig. 6C) e o miR‐223‐3p antagomir melhorou a inflamação alérgica (fig. 6D). Para explorar o efeito do miR‐223‐3p na infiltração de células inflamatórias na mucosa nasal na RA, as células eosinófilas foram subsequentemente contadas. Observamos um número significativamente maior de células eosinófilas na mucosa nasal em camundongos com RA do que em camundongos controle. Além disso, a administração intranasal de miR‐223‐3p agomir aumentou acentuadamente o número de células eosinófilas, o qual foi reduzido no grupo tratado com miR‐223‐3p antagomir (fig. 6E). Esses dados demonstram que o miR‐223‐3p pode promover patologia alérgica com infiltração de células imunes na mucosa nasal de camundongos com RA.

Figura 6.

MiR‐223‐3p promoveu uma resposta inflamatória alérgica na mucosa nasal de camundongos com RA. (A ‐ D) As alterações patológicas na mucosa nasal de cada grupo foram analisadas com coloração H&E. (E) O número de eosinófilos em cada grupo foi quantificado. (* p <0,05, ** p <0,01, *** p <0,001).

(0,26MB).
Verificação do INPP4A como um gene alvo do miR‐223‐3p

Para investigar mais detalhadamente os mecanismos pelos quais o miR‐223‐3p promoveu respostas e sintomas alérgicos em camundongos com RA, os genes‐alvo potenciais do miR‐223‐3p foram previstos com o uso dos bancos de dados de previsão de gene‐alvo do miRNA em TargetScan (http://www.targetscan.org/vert_71/), miRWalk (http://mirwalk.umm.uni‐heidelberg.de/) e miRDB (http://www.mirdb.org/). Especificamente, foi previsto que o miR‐223‐3p pode ter diretamente como alvo o inositol polifosfato 4 fosfatase (INPP4A), um gene conhecido por estar envolvido em asma e distúrbios alérgicos.24 Como mostrado na figura 7A, um fragmento de 8 pb da 3’UTR do gene INPP4A é complementar à sequência seed do miR‐223‐3p. Para verificar essa previsão, a superexpressão ou knockdown bem‐sucedido do miR‐223‐3p nas células HEK293T foi verificado por PCR quantitativo em tempo real. Como mostrado na figura 7B, a superexpressão de miR‐223‐3p por transfecção de miR‐223‐3p agomir diminuiu acentuadamente a expressão de mRNA do INPP4A, que foi notavelmente restaurada via transdução do miR‐223‐3p antagomir. Esses resultados sugerem que o miR‐223‐3p pode promover respostas inflamatórias alérgicas, regula negativamente a expressão de INPP4A.

Figura 7.

MiR‐223‐3p regula negativamente a expressão de INPP4A. (A) Figura esquemática do mRNA de INPP4A mostra um sítio potencial na região INPP4A 3’‐UTR para miR‐223‐3p. (B) A análise por qRT‐PCR dos níveis de mRNA de INPP4A em células HEK293T transfectadas com miR‐223‐3p agomir ou miR‐223‐3p antagomir. A significância estatística foi avaliada com o teste post hoc de comparação múltipla de Tukey. A barra de erro indica o DP. (* p <0,05).

(0,09MB).
Discussão

Nas últimas décadas, os miRNAs surgiram como moléculas reguladoras críticas as quais se acredita estarem envolvidas na patogênese de várias doenças.25,26 Eles degradam seus alvos cognatos e controlam a expressão gênica no nível pós‐transcricional, ligam as 3’UTRs de seus mRNAs alvo.27 Estudos demonstraram que a estabilidade dos miRNAs poderia ser explorada para modular clinicamente a expressão gênica em várias doenças, inclusive a RA.26,28 Por exemplo, o miRNA‐200a afetou a proliferação de células musculares lisas das vias aéreas e a remodelação das vias aéreas ao ter o gene FOXC como alvo.29 Além disso, a superexpressão do miRNA‐485 modulou a via de sinalização do TGF‐β/Smads em camundongos com asma crônica tendo como alvo o gene Smurf2.30 Além disso, o miRNA‐155 desempenha papéis críticos na expressão de fatores Th2 e na resposta inflamatória alérgica na rinite alérgica.31 Que seja de nosso conhecimento, o presente estudo é o primeiro a demonstrar que o miR‐223‐3p suprime a expressão de INPP4A e promove a inflamação alérgica em um modelo de camundongos com RA.

Um estudo recente demonstrou que o miR‐223 afeta a via de sinalização de PI3K/Akt ao ter como alvo o IGF‐1R e pode se tornar um alvo promissor para o futuro tratamento da asma e remodelação das vias aéreas.32 Além disso, foi relatado que o miR‐223‐3p promove a apoptose e inibe a proliferação de células hep3B através da regulação do NLRP3.33 Além disso, também foi relatado que o miRNA‐133b foi capaz de melhorar a inflamação e os sintomas alérgicos em um modelo murino de rinite alérgica, tendo como alvo o Nlrp3.21 Adicionalmente, verificou‐se que a expressão do miR‐223‐3p é maior na sinóvia dos pacientes com artrite reumatoide (AR) do que na sinóvia dos pacientes com osteoartrite devido ao aumento do número de células positivas para miR‐223‐3p.34 As células T de pacientes com AR também apresentam níveis mais altos de miR‐223‐3p.35,36 Em concordância com um estudo anterior, verificou‐se que os níveis séricos de miR‐223‐3p aumentaram em pacientes com RA em comparação com indivíduos saudáveis em nossa pesquisa. Esses resultados sugeriram ainda que o miR‐223‐3p pode regular positivamente as propriedades pró‐alérgicas da RA. Dentre os pacientes com RA dos quais as amostras foram obtidas, aproximadamente 4,9% tinham histórico de asma, o que representou uma proporção muito baixa. Eles não enfrentavam uma crise de asma no momento da amostragem e o intervalo entre as crises e a amostragem foi muito longo (mais de dois anos para todos os pacientes). Portanto, a asma não é considerada como tendo um impacto externo nos resultados gerais de nosso estudo. Assim, administramos miR‐223‐3p agomir ou antagomir nas cavidades nasais de um modelo de camundongos com RA e investigamos os efeitos significantes do miR‐223‐3p nos sintomas e patogênese da RA. Como esperado, a expressão do miR‐223‐3p foi acentuadamente promovida após a administração do miR‐223‐3p agomir. Além disso, foi determinado que a concentração sérica de IgE específica para OVA e as frequências de prurido e espirro foram mais altas em camundongos com RA do que nos camundongos controle. Essas manifestações foram muito mais graves em camundongos tratados com miR‐223‐3p agomir do que nos camundongos que pertenciam ao grupo que constituía o modelo de RA. Indicaram que a administração intranasal de miR‐223‐3p agomir pode de fato promover a resposta alérgica da RA. Em contraste, os níveis de IgE específica para OVA e os escores dos sintomas foram muito mais baixos nos camundongos tratados com miR‐223‐3p antagomir do que nos camundongos do modelo de RA, o que indica que a administração intranasal de miR‐223‐3p antagomir pode aliviar a patologia e os sintomas da RA.

Como a RA é um distúrbio inflamatório da mucosa nasal, os pesquisadores descobriram que muitas células inflamatórias, como mastócitos basofílicos e eosinófilos, se infiltram nas vias aéreas superiores.27,37 Além disso, as reações de fase tardia na inflamação alérgica são reguladas pelos eosinófilos. A infiltração dessas células inflamatórias leva à produção de muitas citocinas pró‐inflamatórias, leucotrienos e histamina. Dessa forma, desencadeia sintomas alérgicos na RA. É importante ressaltar que as respostas imunológicas mediadas por Th2 resultam em doenças inflamatórias alérgicas e a inflamação alérgica típica da RA pode ser inibida pelo esgotamento das células Th2. Um estudo recente de Schwindt et al.38 descreveu que citocinas Th2, como IL4 e IL5, atuam como reguladores da diferenciação de células T e da troca do isotipo IgE nas células B. Além disso, os autores descobriram que as citocinas Th1 (IFN‐γ) podem ativar a produção de citocinas das células Th2 na resposta alérgica. Neste estudo, as citocinas (IL‐4, IL‐5, IFN‐γ) derivadas de células Th1 ou Th2 estavam aumentadas na RA, desempenharam, assim, papéis importantes na regulação das respostas imunológicas. Aqui, descobrimos que os níveis up‐regulados das citocinas (IL‐4, IL‐5, IFN‐γ) através da administração intranasal de miR‐223‐3p agomir foram revertidos pelo miR‐223‐3p antagomir. Além disso, descobrimos que a administração intranasal de miR‐223‐3p agomir estimula a infiltração de eosinófilos na mucosa nasal de camundongos com RA, enquanto o miR‐223‐3p antagomir inibe essas alterações patológicas. Esses resultados sugerem que o miR‐223‐3p pode estar envolvido na regulação dos efeitos pró‐inflamatórios na RA.

Estudos anteriores demonstraram que polimorfismos no gene INPP4A estão associados à asma em seres humanos, possivelmente devido à menor estabilidade proteica.39 Além disso, o INPP4A também demonstrou ser um regulador (checkpoint) molecular crucial no controle da via de sinalização PI3K‐Akt e é down‐regulado na inflamação alérgica das vias aéreas.40 Além disso, o INPP4A está envolvido na regulação da asma atópica e pode abrir novos caminhos para a intervenção terapêutica, através da modulação da via PI3K‐Akt.24 É importante ressaltar que, neste estudo, nossos dados revelaram que o miR‐223‐3p afetou a expressão de INPP4A ao se ligar diretamente à 3’UTR do INPP4A. As células HEK293T transfectadas com miR‐223‐3p agomir mostraram diminuição da expressão de INPP4A, enquanto o miR‐223‐3p antagomir aumentou a expressão gênica acima, sugeriu que o miR‐223‐3p promove a inflamação alérgica ao inibir a ativação de INPP4A em camundongos com RA. Embora tenhamos confirmado o efeito‐alvo do miR‐223‐3p na expressão de INPP4A a nível celular, determinaremos ainda mais a relação entre miR‐223‐3p e INPP4A através de outros ensaios in vivo. Como os miRNAs são diretamente responsáveis por vários aspectos diferentes, como inflamação, ciclo celular, apoptose e migração celular, o INPP4A é apenas um dos mecanismos possíveis. Assim, também estudaremos o papel principal dos miRNAs no mecanismo da RA sob outros aspectos.

Conclusão

Nossos resultados sugerem que o miR‐223‐3p desempenha um papel essencial no início e no desenvolvimento da inflamação alérgica das vias aéreas. A superexpressão do miR‐223‐3p estimula acentuadamente a doença da RA ao promover respostas inflamatórias, que incluem aumento da IgE sérica específica para OVA, infiltração de eosinófilos e níveis de citocinas pró‐inflamatórias, enquanto a down‐regulação do miR‐223‐3p teve um efeito anti‐inflamatório via regulação negativa do INPP4A. Em geral, nossos resultados mostram que o miR‐223‐3p desempenha um papel importante na mediação da inflamação alérgica, tendo como alvo o gene INPP4A.

Financiamento

Nantong Science and Technology Project Grant (n° MS12018071), Jieping Wu Medical Foundation Clinical Research Project Grant (n° 320.6750.18272) e Scientific Research Project of Jiangsu Health and Family Planning Commission Grant (n° Y2018100).

Conflitos de interesse

Os autores declaram não haver conflitos de interesse.

Referências
[1]
X. Cui, Y. Guo, Q. Wang, X. Li.
MiR‐199‐3p‐Dnmt3a‐STAT3 signalling pathway in ovalbumin‐induced allergic rhinitis.
Exp Physiol., 104 (2019), pp. 1286-1295
[2]
J. Bousquet, N. Khaltaev, A.A. Cruz, J. Denburg, W.J. Fokkens, A. Togias, Allergic Rhinitis and its Impact on Asthma (ARIA) 2008 update (in collaboration with the World Health Organization, GA (2) LEN and AllerGen), et al.
[3]
L. Zhang, D. Han, D. Huang, Y. Wu, Z. Dong, G. Xu, et al.
Prevalence of self‐reported allergic rhinitis in eleven major cities in china.
Int Arch Allergy Immunol., 149 (2009), pp. 47-57
[4]
J.L. Brozek, J. Bousquet, I. Agache, A. Agarwal, C. Bachert, S. Bosnic-Anticevich, et al.
Allergic Rhinitis and its Impact on Asthma (ARIA) guidelines‐2016 revision.
J Allergy Clin Immunol., 140 (2017), pp. 950-958
[5]
E.O. Meltzer.
Quality of life in adults and children with allergic rhinitis.
J Allergy Clin Immunol., 108 (2001), pp. S45-S53
[6]
B. Leynaert, C. Neukirch, R. Liard, J. Bousquet, F. Neukirch.
Quality of life in allergic rhinitis and asthma. A population‐based study of young adults.
Am J Respir Crit Care Med., 162 (2000), pp. 1391-1396
[7]
Z.J. Wu, X. Du, J. Zheng.
Role of Lactobacillus in the prevention of Clostridium difficile‐associated diarrhea: a meta‐analysis of randomized controlled trials.
Chin Med J (Engl)., 126 (2013), pp. 4154-4161
[8]
H.H. Pua, K.M. Ansel.
MicroRNA regulation of allergic inflammation and asthma.
Curr Opin Immunol., 36 (2015), pp. 101-108
[9]
A.N. Greiner, P.W. Hellings, G. Rotiroti, G.K. Scadding.
Allergic rhinitis.
Lancet., 378 (2011), pp. 2112-2122
[10]
B. Steelant, R. Farre, P. Wawrzyniak, J. Belmans, E. Dekimpe, H. Vanheel, et al.
Impaired barrier function in patients with house dust mite‐induced allergic rhinitis is accompanied by decreased occludin and zonula occludens‐1 expression.
J Allergy Clin Immunol., 137 (2016), pp. 1043-1053
[11]
I. Shefler, P. Salamon, Y.A. Mekori.
MicroRNA Involvement in Allergic and Non‐Allergic Mast Cell Activation.
Int J Mol Sci., (2019), pp. 20
[12]
D.P. Bartel.
MicroRNAs: target recognition and regulatory functions.
Cell., 136 (2009), pp. 215-233
[13]
F. Wahid, A. Shehzad, T. Khan, Y.Y. Kim.
MicroRNAs: synthesis, mechanism, function, and recent clinical trials.
Biochim Biophys Acta., 1803 (2010), pp. 1231-1243
[14]
X. Chen, H. Liang, J. Zhang, K. Zen, C.Y. Zhang.
Secreted microRNAs: a new form of intercellular communication.
Trends Cell Biol., 22 (2012), pp. 125-132
[15]
P.S. Mitchell, R.K. Parkin, E.M. Kroh, B.R. Fritz, S.K. Wyman, E.L. Pogosova-Agadjanyan, et al.
Circulating microRNAs as stable blood‐based markers for cancer detection.
Proc Natl Acad Sci U S A., 105 (2008), pp. 10513-10518
[16]
H.R. Chiang, L.W. Schoenfeld, J.G. Ruby, V.C. Auyeung, N. Spies, D. Baek, et al.
Mammalian microRNAs: experimental evaluation of novel and previously annotated genes.
Genes Dev., 24 (2010), pp. 992-1009
[17]
P.B. Singh, H.H. Pua, H.C. Happ, C. Schneider, J. von Moltke, R.M. Locksley, et al.
MicroRNA regulation of type 2 innate lymphoid cell homeostasis and function in allergic inflammation.
J Exp Med., 214 (2017), pp. 3627-3643
[18]
K. Specjalski, E. Jassem.
MicroRNAs: Potential Biomarkers and Targets of Therapy in Allergic Diseases?.
Arch Immunol Ther Exp (Warsz)., 67 (2019), pp. 213-223
[19]
H. Suojalehto, E. Toskala, M. Kilpelainen, M.L. Majuri, C. Mitts, I. Lindstrom, et al.
MicroRNA profiles in nasal mucosa of patients with allergic and nonallergic rhinitis and asthma.
Int Forum Allergy Rhinol., 3 (2013), pp. 612-620
[20]
B. Hou, M. Murata, A.S. Said, H. Sakaida, S. Masuda, T. Takahashi, et al.
Changes of micro‐RNAs in asymptomatic subjects sensitized to Japanese cedar pollen after prophylactic sublingual immunotherapy.
Allergy Rhinol (Providence)., 6 (2015), pp. 33-38
[21]
L. Xiao, L. Jiang, Q. Hu, Y. Li.
MicroRNA‐133b Ameliorates Allergic Inflammation and Symptom in Murine Model of Allergic Rhinitis by Targeting Nlrp3.
Cell Physiol Biochem., 42 (2017), pp. 901-912
[22]
J.S. Bae, J.H. Kim, E.H. Kim, J.H. Mo.
The Role of IL‐17 in a Lipopolysaccharide‐Induced Rhinitis Model.
Allergy Asthma Immunol Res., 9 (2017), pp. 169-176
[23]
R.G. Klein Wolterink, A. Kleinjan, M. van Nimwegen, I. Bergen, M. de Bruijn, Y. Levani, et al.
Pulmonary innate lymphoid cells are major producers of IL‐5 and IL‐13 in murine models of allergic asthma.
Eur J Immunol., 42 (2012), pp. 1106-1116
[24]
M. Sharma, J. Batra, U. Mabalirajan, S. Sharma, R. Nagarkatti, J. Aich, et al.
A genetic variation in inositol polyphosphate 4 phosphatase a enhances susceptibility to asthma.
Am J Respir Crit Care Med., 177 (2008), pp. 712-719
[25]
R.P. Panganiban, Y. Wang, J. Howrylak, V.M. Chinchilli, T.J. Craig, A. August, et al.
Circulating microRNAs as biomarkers in patients with allergic rhinitis and asthma.
J Allergy Clin Immunol., 137 (2016), pp. 1423-1432
[26]
X.H. Zhang, Y.N. Zhang, Z. Liu.
MicroRNA in chronic rhinosinusitis and allergic rhinitis.
Curr Allergy Asthma Rep., 14 (2014), pp. 415
[27]
Y.Q. Deng, Y.Q. Yang, S.B. Wang, F. Li, M.Z. Liu, Q.Q. Hua, et al.
Intranasal Administration of Lentiviral miR‐135a Regulates Mast Cell and Allergen‐Induced Inflammation by Targeting GATA‐3.
PLoS One., 10 (2015), pp. e0139322
[28]
Y. Teng, R. Zhang, H. Yu, H. Wang, Z. Hong, W. Zhuang, et al.
Altered MicroRNA Expression Profiles in Activated Mast Cells Following IgE‐FcepsilonRI Cross‐Linking with Antigen.
Cell Physiol Biochem., 35 (2015), pp. 2098-2110
[29]
Y. Liu, Y. Miao, X. Gao, Y.Y. Wang, H. Wang, Y.W. Zheng, et al.
MicroRNA‐200a Affects the Proliferation of Airway Smooth Muscle Cells and Airway Remodeling by Targeting FOXC1 via the PI3K/AKT Signaling Pathway in Ovalbumin‐Induced Asthmatic Mice.
Cell Physiol Biochem., 50 (2018), pp. 2365-2389
[30]
J. Wang, H.Y. Li, H.S. Wang, Z.B. Su.
MicroRNA‐485 Modulates the TGF‐beta/Smads Signaling Pathway in Chronic Asthmatic Mice by Targeting Smurf2.
Cell Physiol Biochem., 51 (2018), pp. 692-710
[31]
Y.Q. Zhu, B. Liao, Y.H. Liu, Z. Wang, X.H. Zhu, X.B. Chen, et al.
MicroRNA‐155 plays critical effects on Th2 factors expression and allergic inflammatory response in type‐2 innate lymphoid cells in allergic rhinitis.
Eur Rev Med Pharmacol Sci., 23 (2019), pp. 4097-4109
[32]
D. Liu, J. Pan, D. Zhao, F. Liu.
MicroRNA‐223 inhibits deposition of the extracellular matrix by airway smooth muscle cells through targeting IGF‐1R in the PI3K/Akt pathway.
Am J Transl Res., 10 (2018), pp. 744-752
[33]
L. Wan, X. Yuan, M. Liu, B. Xue.
miRNA‐223‐3p regulates NLRP3 to promote apoptosis and inhibit proliferation of hep3B cells.
Exp Ther Med., 15 (2018), pp. 2429-2435
[34]
H. Shibuya, T. Nakasa, N. Adachi, Y. Nagata, M. Ishikawa, M. Deie, et al.
Overexpression of microRNA‐223 in rheumatoid arthritis synovium controls osteoclast differentiation.
Mod Rheumatol., 23 (2013), pp. 674-685
[35]
V. Fulci, G. Scappucci, G.D. Sebastiani, C. Giannitti, D. Franceschini, F. Meloni, et al.
miR‐223 is overexpressed in T‐lymphocytes of patients affected by rheumatoid arthritis.
Hum Immunol., 71 (2010), pp. 206-211
[36]
M.C. Lu, C.L. Yu, H.C. Chen, H.C. Yu, H.B. Huang, N.S. Lai.
Increased miR‐223 expression in T cells from patients with rheumatoid arthritis leads to decreased insulin‐like growth factor‐1‐mediated interleukin‐10 production.
Clin Exp Immunol., 177 (2014), pp. 641-651
[37]
M. Benson, I.L. Strannegard, O. Strannegard, G. Wennergren.
Topical steroid treatment of allergic rhinitis decreases nasal fluid TH2 cytokines, eosinophils, eosinophil cationic protein, and IgE but has no significant effect on IFN‐gamma, IL‐1beta, TNF‐alpha, or neutrophils.
J Allergy Clin Immunol., 106 (2000), pp. 307-312
[38]
R.A. Settipane, C. Schwindt.
Chapter 15: Allergic rhinitis.
Am J Rhinol Allergy., 27 (2013), pp. 52-55
[39]
A. Agrawal, A. Sinha, T. Ahmad, J. Aich, P. Singh, A. Sharma, et al.
Maladaptation of critical cellular functions in asthma: bioinformatic analysis.
Physiol Genomics., 40 (2009), pp. 1-7
[40]
J. Aich, U. Mabalirajan, T. Ahmad, K. Khanna, R. Rehman, A. Agrawal, et al.
Resveratrol attenuates experimental allergic asthma in mice by restoring inositol polyphosphate 4 phosphatase (INPP4A).
Int Immunopharmacol., 14 (2012), pp. 438-443

Yong Zhou e Ting Zhang contribuiram de forma igual como co‐autores.

Como citar este artigo: Zhou Y, Zhang T, Yan Y, You B, You Y, Zhang W, et al. MicroRNA‐223‐3p regulates allergic inflammation by targeting INPP4A. Braz J Otorhinolaryngol. 2021;87:591–600.

A revisão por pares é da responsabilidade da Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico‐Facial.

Copyright © 2020. Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial
Idiomas
Brazilian Journal of Otorhinolaryngology

Receba a nossa Newsletter

Opções de artigo
Ferramentas