Compartilhar
Informação da revista
Vol. 85. Núm. 6.
Páginas 705-715 (Novembro - Dezembro 2019)
Compartilhar
Compartilhar
Baixar PDF
Mais opções do artigo
Visitas
...
Vol. 85. Núm. 6.
Páginas 705-715 (Novembro - Dezembro 2019)
Artigo original
DOI: 10.1016/j.bjorlp.2018.05.018
Open Access
Serum‐ and glucocorticoid‐inducible kinase 3 is a potential oncogene in nasopharyngeal carcinoma
Quinase 3 sérica induzida por glicocorticoide é um potencial oncogene no carcinoma nasofaríngeo
Visitas
...
Jing Chena, Hai Liang Lib,c, Bo Bo Lid,e, Wei Lia, Dong Maf, Yong He Lia,
, Tao Liug,**
a Zhujiang Hospital, Southern Medical University, Department of Otolaryngology, Guangzhou, Guangdong, China
b Jinan University, Zhuhai People's Hospital, Xiangzhou District, Guangdong, China
c University of Science and Technology of China, School of Life Sciences and Medical Center, The Chinese Academy of Sciences Key Laboratory of Innate Immunity and Chronic Diseases, Anhui, China
d Guangdong Provincial Hospital of Chinese Medicine, Department of Otolaryngology, Guangdong, China
e The 2nd Clinical College of Guangzhou University of Chinese Medicine, Guangzhou, China
f Jinan University, Department of Biomedical Engineering, Key Laboratory of Biomaterials of Guangdong Higher Education Institutes, Guangdong, China
g Guangdong Academy of Medical Sciences, Guangdong General Hospital, Department of Otolaryngology, Guangdong, China
Informação do artigo
Resume
Texto Completo
Bibliografia
Baixar PDF
Estatísticas
Figuras (5)
Mostrar maisMostrar menos
Tabelas (3)
Tabela 1. Características clínico‐patológicas de pacientes e tecidos de CNF
Tabela 2. Comparação de sexo e idade entre pacientes com CNF e casos com nasofaringite crônica
Tabela 3. Correlação da expressão de SGK3 em tecidos de CNF (n = 42)
Mostrar maisMostrar menos
Abstract
Introduction

Serum‐ and glucocorticoid‐inducible kinase 3, a serine/threonine kinase that functions downstream of the PI3K signaling pathway, plays a critical role in neoplastic processes. It is expressed by various tumors and contributes to carcinogenesis.

Objective

The objective was to investigate serum‐ and glucocorticoid‐inducible kinase 3 expression in nasopharyngeal carcinoma, to study the anti‐tumor effects of serum‐ and glucocorticoid‐inducible kinase 3 shRNA by inhibiting its expression in nasopharyngeal carcinoma cells and to discuss the potential implications of our findings.

Methods

Serum‐ and glucocorticoid‐inducible kinase 3 protein expression in nasopharyngeal carcinoma cell lines (CNE‐1, CNE‐2, HNE‐1, HONE‐1, and SUNE‐1) and the human immortalized nasopharyngeal epithelium cell line NP69 were assayed by western blotting. Serum‐ and glucocorticoid‐inducible kinase 3 expression in 42 paraffin‐embedded nasopharyngeal carcinoma tissues were performed by immunohistochemistry. MTT assay, flow cytometry, and scratch tests were performed after CNE‐2 cells were transfected with the best serum‐ and glucocorticoid‐inducible kinase 3 shRNA plasmid selected by western blotting using lipofectamine to study its effect on cell proliferation, apoptosis, and migration.

Results

Serum‐ and glucocorticoid‐inducible kinase 3 was overexpressed in human nasopharyngeal carcinoma tissues and cells. Serum‐ and glucocorticoid‐inducible kinase 3 expression decreased markedly after CNE‐2 cells were transfected with the serum‐ and glucocorticoid‐inducible kinase 3 shRNA, leading to strong inhibition of cell proliferation and migration. In addition, the apoptosis rate increased in CNE‐2 cells after serum‐ and glucocorticoid‐inducible kinase 3 knockdown.

Conclusion

Serum‐ and glucocorticoid‐inducible kinase 3 expression was more frequently observed as the nasopharyngeal epithelium progresses from normal tissue to carcinoma. This suggests that serum‐ and glucocorticoid‐inducible kinase 3 contributes to the multistep process of NPC carcinogenesis. Serum‐ and glucocorticoid‐inducible kinase 3 represents a target for nasopharyngeal carcinoma therapy, and a basis exists for the further investigation of this adjuvant treatment modality for nasopharyngeal carcinoma.

Keywords:
Nasopharyngeal carcinoma
Serum‐ and glucocorticoid‐inducible kinase 3
shRNA
Proliferation
Apoptosis
Migration
Resumo
Introdução

A quinase 3 sérica induzida por glicocorticoide, uma serina/treonina quinase que funciona downstream da via de sinalização PI3K, desempenha um papel crítico nos processos neoplásicos. É expressa por vários tumores e contribui para a carcinogênese.

Objetivo

Investigar a expressão de quinase 3 sérica induzida por glicocorticoide no carcinoma nasofaríngeo, estudar os efeitos antitumorais do shRNA da quinase 3 sérica induzida por glicocorticoide, que inibem sua expressão em células de carcinoma nasofaríngeo, e discutir as implicações potenciais de nossos achados.

Método

A expressão de proteína quinase 3 sérica induzida por glicocorticoide em linhagens de células de carcinoma nasofaríngeo (CNE‐1, CNE‐2, HNE‐1, HONE‐1 e SUNE‐1) e a linhagem de células humanas imortalizadas do epitélio nasofaríngeo NP69 foram avaliadas por Western blot. A expressão da quinase 3 sérica induzida por glicocorticoide em 42 tecidos de CNF embebidos em parafina foi feita por imuno‐histoquímica. Testes com MTT, citometria de fluxo e testes de raspagem foram feitos após as células CNE‐2 terem sido transfectadas com o melhor plasmídeo shRNA da quinase 3 sérica induzida por glicocorticoide selecionado por Western blot, com o uso de lipofectamina para estudar seu efeito na proliferação, apoptose e migração celular.

Resultados

Foi observada uma sobre‐expressão da quinase 3 sérica induzida por glicocorticoide em tecidos e células de carcinoma nasofaríngeo humanas. A expressão de quinase 3 sérica induzida por glicocorticoide diminuiu acentuadamente após as células CNE‐2 terem sido transfectadas com o shRNA da quinase 3 sérica induzida por glicocorticoide, conduzindo a forte inibição de proliferação e migração celular. Além disso, a taxa de apoptose aumentou nas células CNE‐2 após o knockdown da quinase 3 sérica induzida por glicocorticoide.

Conclusão

A expressão de quinase 3 sérica induzida por glicocorticoide foi observada com maior frequência à medida que o epitélio nasofaríngeo progride de tecido normal para carcinoma. Isso sugere que a quinase 3 sérica induzida por glicocorticoide contribui para o processo multietapas da carcinogênese do carcinoma nasofaríngeo. A quinase 3 sérica induzida por glicocorticoide representa um alvo para a terapia do carcinoma nasofaríngeo e há uma base para a investigação adicional dessa modalidade de tratamento adjuvante para o carcinoma nasofaríngeo.

Palavras‐chave:
Carcinoma nasofaríngeo
Quinase 3 sérica e induzida por glicocorticoide
shRNA
Proliferação
Apoptose
Migração
Texto Completo
Introdução

O carcinoma de nasofaringe (CNF) é um dos tumores de cabeça e pescoço mais comuns, origina‐se da mucosa da nasofaringe.1 Sua ocorrência é frequente no sul da China e no sudeste da Ásia devido à sua distribuição regional e agregação familiar.2 O CNF é especialmente comum na China, com uma incidência de 20/100.000, mas extremamente raro nos países ocidentais, com uma incidência de menos de 1/100.000.3

Os tipos histopatológicos de CNF são em sua maioria carcinomas de células escamosas pouco diferenciados, que exibem um alto grau de metástase linfonodal cervical e malignidade no estágio inicial.4 Estima‐se que ocorreram 60.600 casos incidentes de CNF e 34.100 mortes relatadas na China em 2015.5 Além disso, o número de novos casos de CNFs tem aumentado exponencialmente.

O tratamento abrangente consiste em radioterapia combinada com quimioterapia, é atualmente a principal estratégia de tratamento clínico para CNF,6 a recidiva local e a metástase a distância são as principais razões para o insucesso do tratamento de CNF.7 A patogênese do CNF não é clara e fatores adicionais podem estar envolvidos, como histórico familiar, suscetibilidade genética, fatores ambientais ou estocásticos e infecção pelo vírus Epstein‐Barr (EBV).3 No entanto, os processos moleculares envolvidos na patogênese do CNF ainda não foram bem definidos. Uma melhor compreensão dos mecanismos moleculares da progressão do CNF contribuirá para o desenvolvimento de novas abordagens terapêuticas e a melhoria da sobrevivência de pacientes com CNF.

Quinases séricas induzidas por glicocorticoide (SGKs) são serina/treonina quinases que funcionam downstream da via de sinalização do fosfoinositídeo 3‐quinase (PI3‐K). 8 As SGKs têm 3 isoformas em mamíferos (SGK1, SGK2 e SGK3) e pertencem à família da AGC quinase (proteína quinase A, proteína quinase G e proteína quinase C), semelhantemente à proteína quinase B/AKT.9 As SGKs compartilham grande homologia no domínio da quinase com AKT,10 estão envolvidas na via PI3‐K e regulam processos celulares semelhantes à AKT. Como membro da família SGK, a ativação e a fosforilação da SGK3 na Thr320 pela quinase dependente de fosfoinositídeos‐1 (PDK1) são consideradas uma forma de sinalização independente da AKT no câncer.11 Foi sugerido que a SGK3 desempenha um papel fundamental na gênese e no desenvolvimento de muitos tumores.12–16 Entretanto, pouca atenção tem sido dada aos seus efeitos no CNF.

Neste artigo, analisamos a expressão e os papéis potenciais da SGK3 no CNF humano. Nossos estudos identificam a SGK3 como um novo potencial promotor do desenvolvimento de CNF humano e sugerem um novo alvo terapêutico para o tratamento da doença.

MétodoMaterial

As linhagens de células humanas de CNF (CNE‐1, CNE‐2, HNE‐1, HONE‐1 e SUNE‐1) e a linhagem de células humanas imortalizadas do epitélio nasofaríngeo NP69 foram preservadas pelo nosso laboratório. A CNE1 é uma linhagem de carcinoma de células escamosas bem diferenciada de carcinoma nasofaríngeo; CNE2, HNE1, HONE1, SUNE1 são linhagens de células escamosas pouco diferenciadas de carcinoma nasofaríngeo; a NP69 é uma linhagem de células epitelial nasofaríngeas imortalizadas, apresenta crescimento epitelioide e aderente escamoso, com características normais do epitélio nasofaríngeo. As cinco linhas de células CNF foram cultivadas em meio RPMI‐1640 (Gibco, Life Technologies Inc., Carlsbad, CA, EUA), contêm 10% de soro fetal bovino (FBS, Tianhang Biotechnology Co., Ltd., Zhejiang, China). As células NP69 foram cultivadas em meio queratinócito/isento de soro (K‐SFM; Gibco) suplementado com extrato de pituitária bovina (BPE; Gibco) e fator de crescimento epidérmico (EGF, recombinante humano; Gibco).

Todas as células foram cultivadas a 37 com 5% de CO2. Os plasmídeos SGK3 shRNA foram todos produzidos por GeneCopoeia Inc., Rockville, MD, EUA e incluíram sh1025, sh1132, sh1206 e sh1284; as sequências são 5’‐GCTAGTGCATTGGGTTACTTA‐3’, 5’‐GCTTTGTAAAGAAGGAATTGC‐3’, 5’‐GCCGAGATGTTGCTGAAATGT‐3’, e 5’‐GGTCCATTCTGGAAGAACTCC‐3’, respectivamente. O plasmídeo de controle negativo (CN), sequência 5’‐GCTTCGCGCCGTAGTCTTA‐3’, também foi adquirido da GeneCopoeia Inc. Para se obter a melhor sequência do plasmídeo no silenciamento do gene, as células foram semeadas antes de ser transfectadas e seu crescimento foi permitido até a densidade de 60% no segundo dia. O polímero catiônico PEI (adquirido da Aladdin Inc.) foi usado para transfectar os plasmídeos com diferentes sequências de ShRNA (local silencioso diferente de SGK3) nas células. Após 72 horas, as proteínas das células foram extraídas e Western blot foi usado para observar os efeitos de silenciamento de ShRNA em SGK3 e selecionar o plasmídeo com a melhor sequência de silenciamento. A melhor sequência é 5’‐GCTAGTGCATTGGGTTACTTA‐3’.

Equipamentos principais

A incubadora de dióxido de carbono foi produzida pela Thermo Fisher Scientific Inc., EUA. Micrótomo rotativo HM340E‐ e equipamento de coloração de hematoxilina‐eosina (HE) totalmente automático foram produzidos pela MICROM Inc., Alemanha. O aparelho de eletroforese vertical e o sistema transmembrana foram produzidos pela Bio‐Rad Inc., Hercules, Califórnia, EUA. O sistema de imagem por quimiluminescência ChemiDocTM XRS + também foi produzido pela Bio‐Rad Inc. O citômetro de fluxo BD FACSCaliburTM foi produzido pela BD Biosciences Inc. California, EUA. O microscópio de fluorescência invertida foi produzido por Carl Zeiss Co. Ltd., Alemanha.

Imuno‐histoquímica

Quarenta e duas amostras de tecido embebidas em parafina de CNF e nove amostras de tecido de nasofaringite crônica foram obtidas do Departamento de Otorrinolaringologia do Zhujiang Hospital. Os dados clinicopatológicos são apresentados nas tabelas 1 e 2. A expressão de SGK3 nas amostras foi analisada através de imuno‐histoquímica com o kit de detecção de duas fases Elivision (Kit‐0015; Fuzhou Maixin Biotech. Co., Ltd., China). Essas amostras foram desparafinizadas e pré‐tratadas ao ferver as lâminas em solução tampão citrato (pH 6.0) por 10min. As amostras foram então imersas em peróxido de hidrogênio a 3% por 10min à temperatura ambiente para bloquear a atividade da peroxidase endógena tecidual. Após a lavagem com solução salina tamponada com fosfato (PBS), as amostras foram incubadas com anticorpo policlonal de coelho SGK3 (catálogo n° ab153981; 1: 200; Abcam Company, EUA) a 4°C durante a noite e então as amostras foram incubadas com 50μL de polímero amplificador (reagente A) e 50μL de IgG anticamundongo/coelho conjugado com peroxidade de horseradish (reagente B) durante 30min à temperatura ambiente. Após a lavagem com PBS, as amostras foram coradas com solução cromogênica de diaminobenzidina (DAB) e contrastadas com hematoxilina, diferenciadas com ácido clorídrico em etanol, coradas em azul pela lavagem com água e seladas com resina convencional.17 Os resultados foram avaliados pelo método HSCORE, que incluiu tanto a intensidade quanto o escore de distribuição da coloração específica, avaliados por dois patologistas de forma independente.18 Os escores de distribuição da expressão de SGK3 foram registrados como porcentagens de células coradas positivamente em cada uma das quatro categorias de intensidade, que foram classificadas como 0 (sem coloração), 1 (coloração fraca), 2 (coloração acentuada) e 3 (coloração forte). O HSCORE de cada tecido foi derivado pela soma dos quatro escores de distribuição (D) de cada categoria multiplicados pelos escores de intensidade (i) como mostrado a seguir: HSCORE = ∑D (i), onde D variou de 0% a 100% e i = 0, 1, 2, ou 3. O HSCORE máximo foi 300 e o mínimo foi 0. Um HSCORE = 75 foi usado como o ponto de corte para distinguir entre a expressão positiva e a negativa.

Tabela 1.

Características clínico‐patológicas de pacientes e tecidos de CNF

    Casos de CNF (taxa de casos positivos, %) 
SexoMasculino  31 (73,8%) 
Feminino  11 (26,2%) 
Idade< 55  30 (71,4%) 
≥ 55  12 (28,6%) 
Estágio TT1  8 (19,0%) 
T2  10 (23,8%) 
T3  13 (31,0%) 
T4  11 (26,2%) 
Estágio NN0  6 (14,3%) 
N1  13 (31,0%) 
N2  15 (35,7%) 
N3  8 (19,0%) 
Estágio MMO  38 (90,5%) 
M1  4 (9,5%) 
Estágio clínicoEstágio I  6 (14,3%) 
Estágio II  9 (21,4%) 
Estágio III  15 (35,7%) 
Estágio IV  12 (28,6%) 
Tabela 2.

Comparação de sexo e idade entre pacientes com CNF e casos com nasofaringite crônica

Grupo  Sexoχ2  Idade 
    Masculino  Feminino           
Tecidos de CNF  42  31  11      50,0 ± 11,3     
        2,968  0,085    1,043  0,312 
Tecidos de nasofaringite crônica      39,4 ± 13,4     

Este estudo foi aprovado pelo comitê de ética (n° 2016‐EBYHK‐002).

Análise do Western blot

As proteínas totais foram extraídas de células com tampão de lise RIPA (Kaiji Biotechnology Co., Ltd., Jiangsu, China). As concentrações de proteína foram determinadas com ensaios de proteína (Beyotime Biotechnology Co., Ltd., Xangai, China). As proteínas purificadas (50μL) foram separadas por eletroforese em gel de poliacrilamida com dodecil sulfato de sódio (SDS‐PAGE) e transferidas para membranas de difluoreto de polivinilideno (Millipore, Bedford, MA, EUA). As membranas foram bloqueadas durante 2 horas à temperatura ambiente em leite desnatado a 5% e incubadas durante a noite a 4°C com anticorpo anti‐SGK3 (Abcam Company, 1:1000). Após a incubação com Horseradish Peroxidase (HRP), anticorpo secundário ligado (Biosharp Biotechnology Co., Ltd., Hefei, China) (1:5000), as membranas foram lavadas e as proteínas foram visualizadas com ‐se um kit de quimiluminescência melhorado (PerkinElmer Inc., Waltham, MA, EUA). Os resultados do Western blot foram analisados semiquantitativamente com o software Image Pro Plus.19

Transfecção de plasmídeos e triagem

As células CNE‐2 de fase logarítmica foram semeadas em placas de seis poços durante 24 horas antes da transfecção atingir 80%‐90% de confluência. As células em cada poço foram transfectadas com 4μg de shRNA SGK3 ou plasmídeo CN e 10μL de Lipofectamina 2000 (Invitrogen, Life Technologies Inc., Carlsbad, Califórnia, EUA). Células não tratadas foram usadas como controle. Todas as células foram cultivadas a 37°C por 24 horas. Após determinar o sucesso da transfecção de acordo com o grau de proteína fluorescente verde (GFP, do inglês Green Fluorescent Protein) por microscopia de fluorescência, as células foram cultivadas por mais 48 horas e colhidas para análise de Western blot para identificar o plasmídeo com o maior efeito sobre o knockdown de SGK3.20 As células tratadas foram colhidas para experimentos subsequentes. As células transfectadas com sucesso com o plasmídeo shRNA do SGK3 ou CN foram chamadas de grupo shSGK3 ou CN, respectivamente. As células CNE‐2 serviram como controle branco (grupo controle). Todos os experimentos in vitro foram feitos para cada grupo.

Ensaio da taxa de crescimento

As células CNE‐2 nos três grupos foram cultivadas em placas de 96 poços (5.000 células/poço em 5 poços). O crescimento celular foi avaliado com um ensaio de MTT (brometo de [3‐(4,5‐dimetiltiazol‐2‐il)‐2,5‐difeniltetrazólio) com uma placa conduzida nos pontos temporais indicados durante três dias consecutivos. Cada poço continha 20μL de reagente MTT e foi então cultivado a 37°C por 4 horas. O meio foi descartado e os cristais que se formaram foram dissolvidos em 150μL de dimetil‐sulfóxido (DMSO). As células viáveis em cada poço foram determinadas a cada dia através da medida de um comprimento de onda de absorbância de 490nm. Cada experimento foi repetido de forma independente por três vezes. As curvas de crescimento celular foram subsequentemente geradas.20

Análise do ciclo celular

As células CNE‐2 nos três grupos foram semeadas em placas de seis poços (50.000 células/poço) e cultivadas por 48 horas. No fim da incubação, todas as células foram tripsinizadas, lavadas duas vezes com solução salina pré‐resfriada tamponada com fosfato (PBS, HyClone, Logan, UT, EUA), coletadas e ressuspensas em 100μL de tampão de ligação. Em seguida, 5μL de anexina V‐APC e 5μL de PI foram adicionados e as placas foram incubadas por 30 minutos no escuro à temperatura ambiente. As células foram imediatamente examinadas por citometria de fluxo. Os dados foram analisados pelo software ModFit LT 2.0.21

Testes de raspagem

As células CNE‐2 foram adicionadas a placas de seis poços (50.000 células/poço). Uma vez que as células cresceram até aproximadamente 100% de confluência, os testes de foram feitos com uma ponta de pipeta estéril de 200μL para raspar a monocamada confluente. A área raspada foi lavada com PBS até as células separadas serem removidas. Adicionou‐se meio isento de soro e as células foram cultivadas a 37°C. A distância entre as células na área raspada em 0, 24 e 48 horas foi medida por microscopia.22 A migração celular horizontal foi analisada através do software Image J e calculada com a seguinte fórmula: mobilidade relativa = 1 (largura imediata da raspagem/ largura da raspagem original).

Análise estatística

A avaliação estatística foi feita no programa SPSS 22.0 ou Graph Pad Prism 6. Todos os dados foram adquiridos de pelo menos três experimentos independentes e os resultados são apresentados como média ± desvio padrão. Análise de variância (Anova) de um fator e testes t de Student foram usados para comparar as diferenças de médias entre os grupos.

A associação da expressão de SGK3 com as características clínicas em CNF foi avaliada por análise de regressão logística. Um valor de p < 0,05 indicou uma diferença significante.

ResultadosExpressão de SGK3 em tecidos de CNF

A figura 1A mostra a expressão da proteína SGK3 nos tecidos. As taxas de expressão positiva de SGK3 nos tecidos de CNF e nos tecidos de nasofaringite crônica foram 90,50% (38/42) e 11,10% (1/9), respectivamente. A taxa de expressão de SGK3 em diferentes fases de CNF e nos tecidos de nasofaringite crônica foi avaliada de acordo com o HSCORE.

Figura 1.

Coloração imuno‐histoquímica representativa da SGK3 em tecidos de CNF. (A) Os resultados imuno‐histoquímicos mostraram que a expressão da proteína SGK3 estava localizada principalmente no citoplasma, com expressão fortemente positiva de SGK3 em tecidos de câncer de CNF e sem expressão ou expressão fraca em tecidos de nasofaringite crônica. (B) Taxa de expressão da SGK3 em diferentes estágios de CNF e tecidos de nasofaringite crônica de acordo com o HSCORE. A expressão da SGK3 nos tecidos de CNF de estágio I, II, III e IV foi significativamente maior do que nos tecidos de nasofaringite crônica (p < 0,01). No entanto, não houve diferença significativa entre os diferentes estágios do CNF (p > 0,05).

(0,73MB).

O nível de expressão da SGK3 foi significantemente maior em CNF do que na nasofaringite crônica (p < 0,01) (fig. 1B), indicou que a expressão da SGK3 está relacionada à carcinogênese do CNF. Entretanto, a expressão de SGK3 não foi correlacionada com sexo, idade, estágio TNM ou estágio clínico (p > 0,05) (tabela 3).

Tabela 3.

Correlação da expressão de SGK3 em tecidos de CNF (n = 42)

  SGK3P 
    Expressão positiva(taxa positiva, %)  Expressão negativa   
Sexo
Masculino  31  29 (93,55%)  0,242 
Feminino  11  9 (81,82%)   
Idade
< 55  30  27 (90,0%)  0,633 
≥ 55  12  11 (91,67%)   
Estágio T
T1  12  9 (75,0%)  0,478 
T2  3 (100,0%)   
T3  16  15 (93,75%)   
T4  11  11 (100,0%)   
Estágio N         
N0  5 (83,33%)  0,765 
N1‐3  36  33 (91,67%)   
Estágio M
M0  39  35 (89,74%)  0,500 
M1  3 (100,0%)   
Estágio Clínico
Estágio I  5 (83,33%)  0,536 
Estágio II  7 (77,78%)   
Estágio III  15  14 (93,33%)   
Estágio IV  12  12 (100,0%)   
Expressão de SGK3 em células de CNF

A expressão da proteína SGK3 em diferentes linhagens celulares de CNF e células NP69 é mostrada na figura 2. A SGK3 foi mais altamente expressa na maioria das células de CNF (CNE‐2, HNE‐1, SUNE‐1) do que em células NP69 (p < 0,01). Além disso, as células CNE‐2 e HNE‐1 exibiram níveis mais altos de expressão de SGK3 do que outras linhagens de células de CNF (p < 0,01). Os resultados da análise de Western blot foram consistentes com os da análise imuno‐histoquímica. Esses resultados também indicaram que o SGK3 pode estar intimamente relacionado ao desenvolvimento de CNF.

Figura 2.

Detecção da expressão da proteína SGK3 em linhagens de células de CNF. (A) Expressão representativa da proteína SGK3 em diferentes linhagens celulares de CNF e células NP69 detectadas por análise de Western blot. (B) Análise do valor de cinza da expressão da proteína SGK3 como a proporção entre a SGK3 e a p‐actina nos resultados de Western blot; a SGK3 foi mais altamente expressa na maioria das linhagens de células de CNF (CNE‐2, HNE‐1, SUNE‐1) do que nas células NP69 (p < 0,01).

(0,11MB).
Transfecção in vitro e triagem de plasmídeos

Os plasmídeos SGK3 shRNA e NC foram transfectados com sucesso para as células CNE‐2 (fig. 3A). Os resultados de triagem do plasmídeo shRNA mais eficaz que teve como alvo a SGK3 (shSGK3) são apresentados na figura 3B, que mostra que a proteína SGK3 foi notavelmente reduzida no grupo sh1025 em comparação com os outros grupos de plasmídeo e controle (p < 0,01) (fig. 3B e C). O plasmídeo sh1025 teve o efeito mais significativo no knockdown de SGK3; portanto, as células do grupo sh1025 foram chamadas de grupo hSGK3 e usadas em experiências subsequentes. Os resultados do Western blot mostraram que o nível da proteína SGK3 foi acentuadamente reduzido no grupo shSGK3 em comparação com o grupo CN e controle (p < 0,01) (fig. 3D e E) e nenhuma diferença significativa na expressão de SGK3 foi observada entre o grupo CN e o grupo de controle.

Figura 3.

Melhor rastreamento de shRNA da SGK3 e eficiência do silenciamento da SGK3 pelo shRNA específico em células CNE‐2. (A) Expressão verde fluorescente da proteína em células CNE‐2 observada por microscopia de fluorescência após transfecção com o shRNA da SGK3 ou plasmídeo NC. (B) Expressão representativa da proteína SGK3 em células CNE‐2 tratadas com diferentes plasmídeos de shRNA da SGK3 determinadas por análise de Western blot. (C) Análise do valor de cinza de expressão da proteína SGK3 como a proporção entre a SGK3 e a p‐actina em resultados de Western blot. O plasmídeo sh1025 mostrou o efeito mais significativo no knockdown da SGK3 (p < 0,01). (D) Expressão representativa da proteína SGK3 nos grupos shSGK3, NC e controle determinados por análise de Western blot. (E) Análise do valor cinza da expressão da proteína SGK3 como a proporção entre a SGK3 e a β‐actina nos resultados de Western blot; a expressão da SGK3 no grupo shSGK3 foi obviamente reduzida em comparação com a dos grupos NC e controle (*#p < 0,01).

(0,53MB).
Teste com MTT

Para confirmar o efeito de inibição celular de shRNA SGK3, seus efeitos citotóxicos foram avaliados. A figura 4A mostra uma falha de toxicidade no grupo CN e óbvia citotoxicidade no grupo shSGK3 às 24, 48 e 72 horas (p < 0,01).

Figura 4.

Efeito da down‐regulação da SGK3 na capacidade proliferativa e apoptose de células CNE‐2. Ensaio MTT (A) e análise de apoptose (B e C) por citometria de fluxo nos diferentes grupos. A taxa de viabilidade celular no grupo shSGK3 estava obviamente reduzida em comparação com a dos grupos NC e controle e a taxa de apoptose celular no grupo shSGK3 estava obviamente aumentada em comparação com a dos grupos NC e controle. (*#p < 0,01).

(0,48MB).
Ensaio de apoptose

Para determinar se shRNA SGK3 poderia efetivamente induzir a apoptose celular, determinamos a porcentagem de apoptose celular após as células CNE‐2 terem sido transfectadas com shRNA SGK3. Como mostrado na figura 4B, as células CNE‐2 exibiram apoptose limitada no grupo CN em comparação com o grupo controle, o que foi consistente com os resultados da análise de citotoxicidade. As porcentagens de apoptose celular (inclusive apoptose precoce e tardia) no grupo shSGK3, no grupo NC e no grupo controle após 48 horas foram de 17,85%, 7,49% e 6,70%, respectivamente. As células tratadas com shRNA SGK3 exibiram um aumento mais óbvio na apoptose (p < 0,01) (fig. 4C).

Teste de raspagem celular

Para detectar a capacidade de invasão e metástase das células tumorais, o teste de raspagem celular foi feito no grupo controle, no grupo CN e no grupo shSGK3. Como mostrado na figura 5A, a taxa de migração horizontal de células no grupo shSGK3 após 24 horas foi de 20,50%, enquanto essas taxas foram de 51,60% e 56,60% no grupo CN e controle, respectivamente. Após 48 horas, as células do grupo shSGK3 ainda não haviam se recuperado do dano. A taxa de migração celular horizontal foi de 46,70%, mas os arranhões no grupo CN e no grupo controle eram pouco visíveis. Esses resultados sugerem que a capacidade migratória das células tratadas com shSGK3 foi obviamente diminuída em comparação com a do grupo CN e do grupo controle (p < 0,01) (fig. 5B).

Figura 5.

O efeito da down‐regulação da SGK3 na motilidade das células CNE‐2. (A) Distância em diferentes momentos após o teste da raspagem (ampliação original: X 5). As distâncias das raspagens no grupo shSGK3 não mudaram de maneira óbvia após 24 horas, enquanto as células nos grupos NC e controle exibiram taxas de migração mais altas (p < 0,01). Após 48 horas, as células do grupo shSGK3 ainda não haviam se recuperado do dano (p < 0,01), mas as raspagens celulares dos grupos NC e controle dificilmente eram visíveis. (B) Comparação das taxas de migração celular em diferentes momentos pelo teste de arranhadura; as taxas de migração celular no grupo shSGK3 foram maiores do que as dos grupos NC e controle após 24 e 48 horas (△◊p < 0,01).

(0,91MB).
Discussão

O desenvolvimento e a progressão dos tumores são processos biológicos complexos que envolvem vários genes e vias moleculares. A ativação anormal da via PI3K/AKT e seus alvos downstream foi observada em uma ampla variedade de malignidades humanas, inclusive o CNF.23–25 A SGK3 é uma serina/treonina quinase que funciona downstream de PI3K, compartilha sua similaridade funcional e de sequência com a família AKT e desempenha um papel crítico na sinalização oncogênica independente de AKT.26 Embora muitos estudos mostrem que o SGK3 desempenha um papel importante na regulação da proliferação e migração celular,27–31 as funções do SGK3 no CNF humano permanecem desconhecidas.

Liu M observou que a sobre‐expressão de SGK3 estava significativamente associada a um prognóstico ruim e era mais comum do que a sobre‐expressão de AKT em carcinoma hepatocelular.32 Além disso, Xu J estudou a expressão de SGK3 em 1.340 tumores de mama humanos e descobriu que o SGK3 desempenha um papel importante na sinalização oncogênica independente de AKT.33 Outro estudo mostrou que apenas 36% de ativação de SGK3 foram detectados em um painel de amostras de tumor ovariano, apresentaram baixos níveis de AKT fosforilada, mas com altos níveis de PIK3CA, um gene codificador da subunidade alfa P110 na classe I PI3‐K, e nenhuma correlação foi encontrada entre a fosforilação de SGK3 e a sobre‐expressão de PIK3CA fosforilada ou ativação de AKT.34

No estudo, também encontramos maior expressão de SGK3 em células e tecidos de CNF humanos e a expressão de SGK3 não se correlacionou com sexo, idade, estágio TNM ou estágio clínico. A expressão de SGK3 não se correlacionou de maneira significativa com o prognóstico do CNF, sugeriu que o SGK3 provavelmente não está implicado na sinalização oncogênica aberrante de PI3‐K. No entanto, o número de amostras em nosso estudo não foi suficiente; maiores coortes de pacientes em estudos futuros são necessárias para esclarecer o papel da SGK3 na sinalização oncogênica aberrante de PI3‐K.

Como descrito acima, a SGK3 desempenha um papel importante na regulação da proliferação e migração de células cancerígenas. Pesquisas demonstraram que a Di‐hidrotestosterona (DHT) pode fazer a up‐regulação da expressão de SGK3 via receptor de andrógeno (RA) e promover a proliferação de células de câncer de próstata.35 Sun X descobriu que a sobre‐expressão de SGK3 podia promover a proliferação, sobrevivência, invasão e migração de células de câncer de mama.36 Um experimento funcional in vitro mostrou que a sobre‐expressão da SGK3 podia promover o crescimento celular, a clonogenicidade e o crescimento independente de ancoragem no carcinoma hepatocelular.32 Em contraste, o knockdown da SGK3 poderia inibir significativamente esses processos celulares. Além disso, o estudo também verificou que a sobre‐expressão de SGK3 em células de carcinoma hepatocelular aumentou significativamente a formação e progressão tumoral em camundongos nude em comparação com o uso de células de controle de vetor vazio.

Devido aos altos níveis de expressão de SGK3 nos tecidos e células de CNF, e às funções de SGK3 no processo celular, exploramos ainda mais os efeitos de SGK3 em células de CNF. Silenciamos com sucesso a expressão de SGK3 em células de CNF. Os resultados da transfecção foram verificados por análise de Western blot de diferentes grupos de células. Os ensaios de taxa de crescimento revelaram que as células do grupo shSGK3 apresentavam taxas de proliferação mais baixas na mesma fase logarítmica dos grupos CN e controle. Além disso, as células SGK3 silenciadas apresentavam maiores taxas de apoptose do que as células CN e grupo controle. Além disso, os testes de raspagem verificaram que as células do CNF no grupo shSGK3 eram menos resistentes a danos externos e sua capacidade migratória estava obviamente diminuída. Esses resultados indicam que a expressão de SGK3 exógena pode alterar o comportamento das células de CNF e melhorar significativamente a multiplicação e invasão de células de CNF.

Conclusão

Nosso estudo demonstra que SGK3 apresenta uma sobre‐expressão em células e tecidos de CNF humano e que o silenciamento de SGK3 poderia suprimir a proliferação, sobrevivência e migração de células de CNF. Ele indicou que SGK3 pode contribuir para a patogênese do CNF. SGK3 pode ser um marcador potencial e um alvo terapêutico eficaz no CNF humano.

Financiamento

Fundação Nacional de Ciências Naturais da China (n° 81573000, 81260406 e 51573071).

Conflitos de interesse

Os autores declaram não haver conflitos de interesse.

Referências
[1]
M.L. Chua, J.T. Wee, E.P. Hui, A.T. Chan.
Nasopharyngeal carcinoma.
Lancet, 387 (2016), pp. 1012-1024
[2]
A. Jemal, F. Bray, M.M. Center, J. Ferlay, E. Ward, D. Forman.
Global cancer statistics.
CA Cancer J Clin, 61 (2011), pp. 69-90
[3]
R. He, Z. Hu, Q. Wang, W. Luo, J. Li, L. Duan, et al.
The role of long non‐coding RNAs in nasopharyngeal carcinoma: a systemic review.
Oncotarget, 8 (2017), pp. 16075-16083
[4]
K.W. Fong, E.J. Chua, E.T. Chua, H.S. Khoo-Tan, K.M. Lee, K.S. Lee, et al.
Patient profile and survival in 270 computer tomography‐staged patients with nasopharyngeal cancer treated at the Singapore General Hospital.
Ann Acad Med Singapore, 25 (1996), pp. 341-346
[5]
W. Chen, R. Zheng, P.D. Baade, S. Zhang, H. Zeng, F. Bray, et al.
Cancer statistics in China.
CA Cancer J Clin, 66 (2016), pp. 115-132
[6]
G. Peng, T. Wang, K.Y. Yang, S. Zhang, T. Zhang, Q. Li, et al.
A prospective, randomized study comparing outcomes and toxicities of intensity‐modulated radiotherapy vs. conventional two‐dimensional radiotherapy for the treatment of nasopharyngeal carcinoma.
Radiother Oncol, 104 (2012), pp. 286-293
[7]
A.W. Lee, W.M. Sze, J.S. Au, S.F. Leung, T.W. Leung, D.T. Chua, et al.
Treatment results for nasopharyngeal carcinoma in the modem era, the Hong Kong experience.
Int J Radiat Oncol Biol Phys, 6 (2005), pp. 1107-1116
[8]
M.K. Webster, L. Goya, Y. Ge, A.C. Maiyar, G.L. Firestone.
Characterization of sgk, a novel member of the serine threonine protein kinase gene family which is transcriptionally induced by glucocorticoids and serum.
Mol Cell Biol, 13 (1993), pp. 2031-2040
[9]
T. Kobayashi, M. Deak, N. Morrice, P. Cohen.
Characterization of the structure and regulation of two novel isoforms of serum‐ and glucocorticoid‐induced protein kinase.
Biochem J, 344 (1999), pp. 189-197
[10]
M.A. Bruhn, R.B. Pearson, R.D. Hannan, K.E. Sheppard.
Second AKT, the rise of SGK in cancer signaling.
Growth Factors, 28 (2010), pp. 394-408
[11]
K.M. Vasudevan, D.A. Barbie, M.A. Davies, R. Rabinovsky, C.J. McNear, J.J. Kim, et al.
AKT‐independent signaling downstream of oncogenic PIK3CA mutations in human cancer.
Cancer Cell, 16 (2009), pp. 21-32
[12]
F. Dai, L. Yu, H. He, Y. Chen, J. Yu, Y. Yang, et al.
Human serum and glucocorticoid‐inducible kinase‐like kinase (SGKL) phosphorylates glycogen syntheses kinase 3 beta (GSK‐3beta) at serine‐9 through direct interaction.
Biochem Biophys Res Commun, 293 (2002), pp. 1191-1196
[13]
M. Laplante, D.M. Sabatini.
mTOR signaling in growth control and disease.
[14]
D. Liu, X. Yang, Z. Songyang.
Identification of CISK, a new member of the SGK kinase family that promotes IL‐3‐dependent survival.
Curr Biol, 10 (2000), pp. 1233-1236
[15]
Y. Wang, D. Zhou, S. Phung, S. Masri, D. Smith, S. Chen.
SGK3 is an estrogen‐inducible kinase promoting estrogen‐mediated survival of breast cancer cells.
Mol Endocrinol, 25 (2011), pp. 72-82
[16]
T. Slagsvold, A. Marchese, A. Brech, H. Stenmark.
CISK attenuates degradation of the chemokine receptor CXCR4 via the ubiquitin ligase AIP4.
EMBO J, 25 (2006), pp. 3738-3749
[17]
W.K. Yip, P.Y. He, M.A. Abdullah, S. Yusoff, H.F. Seow.
Increased expression of phosphatidylinositol 3‐kinase p110α and gene amplification of PIK3CA in nasopharyngeal carcinoma.
Pathol Oncol Res, 22 (2016), pp. 413-419
[18]
K.S. McCarty Jr., E. Szabo, J.L. Flowers, E.B. Cox, G.S. Leight, L. Miller, et al.
Use of a monoclonal anti‐estrogen receptor antibody in the immunohistochemical evaluation of human tumors.
Cancer Res, 46 (1986), pp. 4244s-4248s
[19]
Y.T. Lin, H.C. Wang, Y.C. Hsu, C.L. Cho, M.Y. Yang, C.Y. Chien.
Capsaicin induces autophagy and apoptosis in human nasopharyngeal carcinoma cells by downregulating the PI3K/AKT/mTOR pathway.
[20]
Y. Ren, L. Wu, X. Li, W. Li, Y. Yang, M. Zhang.
FBXL10 contributes to the progression of nasopharyngeal carcinoma via involving in PI3K/mTOR pathway.
Neoplasma, 62 (2015), pp. 925-931
[21]
M. Zhao, R. Luo, Y. Liu, L. Gao, Z. Fu, Q. Fu, et al.
miR‐3188 regulates nasopharyngeal carcinoma proliferation and chemosensitivity through a FOXO1‐modulated positive feedback loop with mTOR‐p‐PI3K/AKT‐c‐JUN.
Nat Commun, 7 (2016), pp. 11309
[22]
Y. Li, L. Liu, Z. Yin, H. Xu, S. Li, W. Tao, et al.
Effect of targeted silencing of IL‐8 on in vitro migration and invasion of SKOV3 ovarian cancer cells.
Oncol Lett, 13 (2017), pp. 567-572
[23]
H. Jiang, D. Fan, G. Zhou, X. Li, H. Deng.
Phosphatidylinositol 3‐kinase inhibitor (LY294002) induces apoptosis of human nasopharyngeal carcinoma in vitro and in vivo.
J Exp Clin Cancer Res, 29 (2010), pp. 34
[24]
C.C. Chou, M.J. Chou, C.Y. Tzen.
PIK3CA mutation occurs in nasopharyngeal carcinoma but does not significantly influence the disease‐specific survival.
Med Oncol, 26 (2009), pp. 322-326
[25]
W.K. Yip, V.C. Leong, M.A. Abdullah, S. Yusoff, H.F. Seow.
Overexpression of phospho‐AKT correlates with phosphorylation of EGF receptor FKHR and BAD in nasopharyngeal carcinoma.
Oncol Rep, 19 (2008), pp. 319-328
[26]
M.A. Bruhn, R.B. Pearson, R.D. Hannan, K.E. Sheppard.
AKT‐independent PI3‐K signaling in cancer—emerging role for SGK3.
Cancer Manage Res, 5 (2013), pp. 281-292
[27]
J.A. Gasser, H. Inuzuka, A.W. Lau, W. Wei, R. Beroukhim, A. Toker.
SGK3 mediates INPP4B‐dependent PI3K signaling in breast cancer.
Mol Cell, 56 (2014), pp. 595-607
[28]
S.T. Guo, M.N. Chi, R.H. Yang, X.Y. Guo, L.K. Zan, C.Y. Wang, et al.
INPP4B is an oncogenic regulator in human colon cancer.
Oncogene, 35 (2016), pp. 3049-3061
[29]
B.M. Slomovitz, R.L. Coleman.
The PI3K/AKT/mTOR pathway as a therapeutic target in endometrial cancer.
Clin Cancer Res, 18 (2012), pp. 5856-5864
[30]
Y. Xiaobo, L. Qiang, Q. Xiong, R. Zheng, Z. Jianhua, L. Zhifeng, et al.
Serum and glucocorticoid kinase 1 promoted the growth and migration of non‐small cell lung cancer cells.
[31]
H. Jin, L. Yang, L. Wang, Z. Yang, Q. Zhan, Y. Tao, et al.
INPP4B promotes cell survival via SGK3 activation in NPM1‐mutated leukemia.
J Exp Clin Cancer Res, 37 (2018), pp. 8
[32]
M. Liu, L. Chen, T.H. Chan, J. Wang, Y. Li, Y. Li, et al.
Serum and glucocorticoid kinase 3 at 8q13.1 promotes cell proliferation and survival in hepatocellular carcinoma.
Hepatology, 55 (2012), pp. 1754-1765
[33]
J. Xu, M. Wan, Q. He, R.L. Bassett Jr., X. Fu, A.C. Chen, et al.
SGK3 is associated with estrogen receptor expression in breast cancer.
Breast Cancer Res Treat, 134 (2012), pp. 531-541
[34]
C. De Marco, N. Rinaldo, P. Bruni, C. Malzoni, F. Zullo, F. Fabiani, et al.
Multiple genetic alterations within the PI3K pathway are responsible for AKT activation in patients with ovarian carcinoma.
[35]
Y. Wang, D. Zhou, S. Chen.
SGK3 is an androgen‐inducible kinase promoting prostate cancer cell proliferation through activation of p70 S6 kinase and up‐regulation of cyclin D1.
Mol Endocrinol, 28 (2014), pp. 935-948
[36]
X. Sun, X. Liu, B.O. Liu, S. Li, D. Zhang, H. Guo.
Serum‐and glucocorticoid‐regulated protein kinase 3 overexpression promotes tumor development and aggression in breast cancer cells.
Oncol Lett, 12 (2016), pp. 437-444

Como citar este artigo: Chen J, Li HL, Li BB, Li W, Ma D, Li YH, et al. Serum‐ and glucocorticoid‐inducible kinase 3 is a potential oncogene in nasopharyngeal carcinoma. Br J Otorhinolaryngol. 2018. https://doi.org/10.1016/j.bjorl.2018.05.012

A revisão por pares é da responsabilidade da Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico‐Facial.

Copyright © 2018. Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial
Idiomas
Brazilian Journal of Otorhinolaryngology

Receba a nossa Newsletter

Opções de artigo
Ferramentas
en pt
Cookies policy Política de cookies
To improve our services and products, we use "cookies" (own or third parties authorized) to show advertising related to client preferences through the analyses of navigation customer behavior. Continuing navigation will be considered as acceptance of this use. You can change the settings or obtain more information by clicking here. Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aqui.