Compartilhar
Publique nesta revista
Informação da revista
Vol. 84. Núm. 4.Julho - Agosto 2018Páginas 401-528
Compartilhar
Compartilhar
Baixar PDF
Mais opções do artigo
Visitas
1003
Vol. 84. Núm. 4.Julho - Agosto 2018Páginas 401-528
Artigo original
DOI: 10.1016/j.bjorlp.2017.05.055
IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non‐syndromic cleft palate but not with cleft lip with or without palate in South Indian population
Polimorfismo de nucleotídeo único do gene IRF6 rs2235375 está associado com à fenda palatina isolada não sindrômica, mas não com fenda labial com ou sem fenda palatina em população do sul da Índia
Visitas
1003
Venkatesh Babu Gurramkondaa, Altaf Hussain Syedb, Jyotsna Murthyb, Bhaskar V.K.S. Lakkakulaa,c,
Autor para correspondência
lvksbhaskar@gmail.com

Autor para correspondência.
a Sri Ramachandra University, Department of Biomedical Sciences, Chennai, India
b Sri Ramachandra University, Department of Plastic Surgery, Chennai, India
c Sickle Cell Institute Chhattisgarh, Raipur, India
Este item recebeu
1003
Visitas
Informação do artigo
Resume
Texto Completo
Bibliografia
Baixar PDF
Estatísticas
Tabelas (3)
Tabela 1. Primers usados para genotipagem de IRF6 rs2235375
Tabela 2. Distribuição de genótipos e frequências de alelos do IRF6 rs2235375 SNP em fenda labial e palatina
Tabela 3. Resultados dos testes de associação com IRF6 rs2235375 SNP em fenda labial e palatina
Mostrar maisMostrar menos
Abstract
Introduction

Transcription factors are very diverse family of proteins involved in activating or repressing the transcription of a gene at a given time. Several studies using animal models demonstrated the role of transcription factor genes in craniofacial development.

Objective

We aimed to investigate the association of IRF6 intron‐6 polymorphism in the non‐syndromic cleft lip with or without palate in a South Indian population.

Methods

173 unrelated nonsyndromic cleft lip with or without cleft palate patients and 176 controls without clefts patients were genotyped for IRF6 rs2235375 variant by allele‐specific amplification using the KASPar single nucleotide polymorphism genotyping system. The association between interferon regulatory factor‐6 gene intron‐6 dbSNP208032210:g.G>C (rs2235375) single nucleotide polymorphism and non‐syndromic cleft lip with or without palate risk was investigated by chi‐square test.

Results

There were significant differences in genotype or allele frequencies of rs2235375 single nucleotide polymorphism between controls and cases with non‐syndromic cleft lip with or without palate. IRF6 rs2235375 variant was significantly associated with increased risk of non‐syndromic cleft lip with or without palate in co‐dominant, dominant (OR: 1.19; 95% CI 1.03–2.51; p=0.034) and allelic models (OR: 1.40; 95% CI 1.04–1.90; p=0.028). When subset analysis was applied significantly increased risk was observed in cleft palate only group (OR dominant: 4.33; 95% CI 1.44–12.97; p=0.005).

Conclusion

These results suggest that IRF6 rs2235375 SNP play a major role in the pathogenesis and risk of developing non‐syndromic cleft lip with or without palate.

Keywords:
IRF6
Orofacial clefts
NSCL/P
SNP
Resumo
Introdução

Fatores de transcrição constituem uma família de proteínas muito diversa envolvida na ativação ou repressão da transcrição de um gene, em um determinado momento. Vários estudos usando modelos animais demonstraram o papel dos genes do fator de transcrição no desenvolvimento craniofacial.

Objetivo

Nosso objetivo foi investigar a associação do polimorfismo IRF6 intron‐6 na fenda labial não sindrômica com ou sem fenda palatina em uma população do sul da Índia.

Método

Um total de 173 pacientes com fenda labial não sindrômica com ou sem fenda palatina e 176 controles sem fendas foram genotipados para a variante IRF6 rs2235375 por amplificação alelo‐específica utilizando o sistema KASPar de genotipagem de polimorfismo de nucleotídeo único. A associação entre o polimorfismo de nucleotídeo único Fator 6 Regulatório do Interferon (IRF6) intron‐6 dbSNP208032210:g.G>C (rs2235375) e o risco de fenda labial não sindrômica com ou sem fenda palatina foi investigado pelo teste qui‐quadrado.

Resultados

Houve diferenças significativas nas frequências de genótipos ou alelos do rs2235375 SNP entre controles e casos com fenda labial não sindrômica com ou sem fenda palatina. A variante IRF6 rs2235375 foi significativamente associada ao aumento do risco de fenda labial não sindrômica com ou sem fenda palatina em modelos codominantes, dominantes (OR: 1,19; IC 95%: 1,03‐2,51; p=0,034) e alélicos (OR: 1,40; IC 95%: 1,04‐1,90; p=0,028). Quando a análise do subgrupo foi realizada, um risco significativamente aumentado foi observado no grupo Fenda Palatina Isolada (OR dominante: 4,33; IC 95%: 1,44‐12,97; p=0,005).

Conclusões

Esses resultados sugerem que o polimorfismo de nucleotídeo único IRF6 rs2235375 desempenha um papel importante na patogênese e no risco de desenvolvimento de fenda labial não sindrômica com ou sem fenda palatina.

Palavras‐chave:
IRF6
Fendas orofaciais
NSCL/P
SNP
Texto Completo
Introdução

Fatores de transcrição constituem uma família de proteínas muito diversa, envolvida na ativação ou supressão da transcrição de um gene, em um determinado momento. Durante o desenvolvimento, os fatores de transcrição são responsáveis por direcionar o destino das células individuais. Várias linhas de evidência demonstraram o papel dos genes do fator de transcrição no desenvolvimento craniofacial e também as variantes desses genes desempenhando um papel crucial na etiologia da fenda labial não sindrômica com ou sem fenda palatina (FLNS/P).1,2 O fator regulatório interferon‐6 (IRF6) é um fator de transcrição que codifica o domínio de ligação ao DNA hélice –giro‐ hélice e o domínio de ligação à proteína menos conservado. Nos seres humanos, nove IRFs foram relatados e a análise da composição da sequência de aminoácidos mostrou 89% de similaridade entre IRF6 e IRF5, que desempenham um papel na ativação do interferon e na supressão tumoral.3 A hibridização in situ de embriões de ratos demonstrou que o IRF6 tem alta expressão nas bordas medianas das prateleiras palatinas emparelhadas imediatamente antes e durante a sua fusão. A expressão de IRF6 também foi detectada em folículos capilares, rugas palatinas, germes dentários, ducto tireoglosso, genitália externa e na pele de todo o corpo.4 Pesquisas recentes mostraram que os camundongos com IRF6 mutante exibem uma epiderme hiperproliferativa que não sofre diferenciação terminal, o que leva a múltiplas adesões epiteliais que podem ocluir a cavidade oral e resultar em fenda palatina.5

O Fator Regulatório Interferon‐6 (IRF6) está localizado no cromossomo 1q32.2 e é um dos genes candidatos associados com ambos os tipos de fendas sindrômicas e não sindrômicas.6–8 Além disso, vários estudos de associação do genoma inteiro, GWAS, (do inglês Genome‐Wide Association Studies) identificaram IRF6 como um locus associado com fendas orais.9,10 Esse gene contém 10 exons e, entre eles, os exons 1, 2 e 10 não são codificadores. A proteína codificadora do IRF6 contém um total de 517 aminoácidos e contém um domínio N‐terminal de ligação ao DNA hélice‐ giro‐ hélice e um domínio C‐terminal SMIR (Fator de ligação regulador de interferon). Estudos em seres humanos mostraram que alelos comuns em IRF6 eram associados à FLNS/P em diferentes populações.11

Nosso estudo anterior indicou que haplótipos de dois polimorfismos de genes IRF6 estão associados à FLNS/P.12 Neste estudo, estendemos nosso trabalho anterior para avaliar a associação entre Intron‐6 dbSNP208032210:g.G>C (rs2235375) polimorfismo de nucleotídeo único com o risco de fenda labial não sindrômica com ou sem palato em uma população do sul da Índia.

Método

O Comitê de Ética da Instituição da Universidade Sri Ramachandra, Chennai, Índia, aprovou o projeto do estudo (Ref: IEC‐NI / II / OCT / 25/60 datado de 12.01.2012). Consentimento informado foi obtido dos pais ou responsável legal quando o paciente era menor de idade. O estudo incluiu 176 casos de FLNS/P (77 do sexo feminino e 99 do sexo masculino) e 173 controles (77 do sexo feminino e 96 do sexo masculino). Os participantes do estudo foram recrutados do Centro de Fendas e Craniofacial da Universidade Sri Ramachandra, Chennai, Índia. Dois cirurgiões avaliaram independentemente o fenótipo da fenda, e os casos com retardo mental ou quaisquer outras anomalias foram excluídos do estudo. Dos 176 casos de FLNS/ P, 104 tinham fenda labial com fenda palatina (FL/P; 76 unilateral e 28 bilaterais), 40 tinham apenas fenda labial (FLI) e 29 apenas fenda palatina isolada (FPI). Ambos os casos de FLI e FPI eram unilaterais e nenhum dos pacientes tinha parentes afetados. Indivíduos pareados por idade e gênero sem histórico familiar de fenda foram recrutados como controles. Foi coletada uma amostra de sangue periférico de 3mL de cada indivíduo e o DNA foi extraído utilizando‐se um procedimento padrão.13 A genotipagem do IRF6 rs2235375 SNP foi realizada pela KBioscience usando KASPar.14,15 A genotipagem de polimorfismo de nucleotídeo único através do sistema KASPar envolve PCR alelo‐específica utilizando os oligonucleotídeos FRET quencher cassette (tabela 1). Com base na fluorescência obtida, os dados de chamada de alelos foram visualizados graficamente como um gráfico de dispersão usando o SNPViewer (http://www.lgcgenomics.com). O equilíbrio de Hardy‐Weinberg (EHW) foi avaliado em ambos os casos e grupos de controle usando o teste do qui‐quadrado. As frequências alélicas foram estimadas pelo método de contagem de genes.16 A comparação das frequências de genótipos e alelos entre os casos e os grupos de controle foi analisada pelo teste do qui‐quadrado. O odds ratio e os intervalos de confiança de 95% foram calculados utilizando genótipos e alelos de tipo selvagem como grupo de referência.

Tabela 1.

Primers usados para genotipagem de IRF6 rs2235375

Primersa  Sequênciab 
Alelo 1 (FAM)  5‐ GTAAGTGAGACTTTATCTTTCTTGCTG‐3’ 
Alelo 2 (HEX)  5‐ GTAAGTGAGACTTTATCTTTCTTGCTC‐3’ 
Common reverse  5‐ GAAAGCAGGACAGGAAAGAGTCTATAATA‐3’ 
a

Primers correspondendo a alelos diferentes foram marcados com colorações fluorescentes FAM e HEX (KBiosciences).

b

As bases polimórficas são sublinhadas.

Resultados

A distribuição dos genótipos e alelos da variante IRF6 rs2235375 em ambos os casos e grupos de FLNS/P são apresentados na tabela 2. As proporções de genótipos foram 30,1% GG, 49,7% GC, 20,2% CC nos casos e 40,9% GG, 44,3% GC, e 14,8% CC nos controles. A frequência do alelo C foi 45,1% nos casos e 36,9% nos controles. As frequências do genótipo IRF6 rs2235375 eram distribuídas de acordo com o equilíbrio de Hardy‐Weinberg entre os controles (p = 0,519). Diferença significante nas frequências de alelos foi encontrada entre os grupos controle e os FLNS/P (tabela 3). Odds ratio e IC de 95% foram calculados para avaliar o risco relativo de fendas orais ao comparar as frequências genotípicas de casos e controles em modelos codominantes, dominantes e alélicos (tabela 3). Um risco significantemente maior de FLNS/P foi encontrado para o genótipo homozigoto (CC vs. GG; OR = 1,86; IC 95%: 1,0‐3,47; p = 0,047). Um risco aumentado de FLNS/P também foi encontrado em modelos dominantes (GC + CC vs. GG; OR = 1,19; IC 95% 1,03‐2,51; p = 0,034) e alélicos (C vs. G; OR = 1,40; IC 95%; 1,04 ‐1.90; p = 0,028). Na análise de subgrupos, a variante IRF6 rs2235375 mostrou risco significantemente aumentado de FPI em três modelos diferentes (tabela 3).

Tabela 2.

Distribuição de genótipos e frequências de alelos do IRF6 rs2235375 SNP em fenda labial e palatina

  Controle (%)  Fendas gerais (%)  FL/P (%)  FPI (%) 
Distribuição genotípica
GG  72(40,9)  52(30,1)  48(33,3)  4(13,8) 
GC  78(44,3)  86(49,7)  69(47,9)  17(58,6) 
CC  26(14,8)  35(20,2)  27(18,8)  8(27,6) 
Frequência alélica
Alelo G  222(63,1)  190(54,9)  165(57,3)  25(43,1) 
Alelo C  130(36,9)  156(45,1)  123(42,7)  33(56,9) 
Teste para EHW
Qui‐quadrado  0,417  0,003  0,062  0,996 
p‐valor  0,519  0,959  0,803  0,318 

FL/P, Fenda Labial e Palatina; FPI, Fenda Palatina Isolada; EHW, equilíbrio de Hardy‐Weinberg.

Tabela 3.

Resultados dos testes de associação com IRF6 rs2235375 SNP em fenda labial e palatina

IRF‐6 rs2235375  OR (IC 95%)  p‐valor 
Fendas gerais
GG  Referência  0.085a 
GC  1.53 (0.95‐2.44)  0.077 
CC  1.86 (1.00‐3.47)  0.047 
GC+CC vs. GG  1.19 (1.03‐2.51)  0.034 
Alelo G  Referência   
Alelo C  1.40 (1.04‐1.90)  0.028 
FL/P
GG  Referência  0,334a 
GC  1,33 (0,81‐2,16)  0,225 
CC  1,56 (0,81‐2,99)  0,18 
GC+CC vs. GG  1,38 (0,88‐2,19)  0,163 
Alelo G  Referência   
Alelo C  1,27 (0,93‐1,75)  0,137 
FPI
GG  Referência  0,014a 
GC  3,92 (1,26‐12,21)  0,021 
CC  5,54 (1,54‐19,95)  0,004 
GC+CC vs. GG  4,33 (1,44‐12,97)  0,005 
Alelo G  Referência   
Alelo C  2,25 (1,28‐3,96)  0,003 

IRF6, fator regulador de interferon 6; OR, Odds Ratio; IC, Intervalo de Confiança; FL/P, Fenda Labial e Palatina; FPI, Fenda Palatina Isolada.

Discussão

Nossos achados mostram claramente que o IRF6 rs2235375 desempenha um papel predominante no desenvolvimento de FLNS/P. Este estudo fornece evidências confirmatórias para as variantes que foram relatadas anteriormente, como sendo associadas à FLNS/P. O papel do IRF6 foi identificado durante o desenvolvimento embrionário, mas sua função reguladora ainda precisa ser esclarecida.5,17 No momento da fusão do palato, ocorre a degradação do epitélio da borda medial (EBM) e o aumento da expressão do IRF6 foi observado na EBM durante este processo.18,19 Os padrões de expressão do desenvolvimento de ortólogos do IRF6 em camundongos e pintinhos revelaram presença de expressão do IRF6 na fusão do ectoderma formando o lábio superior e o palato primário em ambos os ratos e pintinhos, mas apenas no desenvolvimento do palato secundário do camundongo.20

Uma meta‐análise de 20 estudos de caso‐controle publicados demonstrou que rs2235371 e rs642961 são antagonistas entre si na atribuição do risco de FLNS /P.21 O alelo “A” de um polimorfismo funcional (rs2235371; 820G > A) contribuiu para um aumento do risco de FLNS/P na população chinesa.22 De maneira inversa, o alelo “G” foi sobre‐transmitido em poucos estudos.11 Poucas análises baseadas em haplótipos confirmaram que o rs2235371 estava associado à FLNS / P.23–25 Em contraste com isso, o SNP rs2235371, não mostrou associação com fendas orais em algumas populações.26–29 Demonstramos anteriormente que o alelo G do IRF6 rs2235371 é sobre‐transmitido em pacientes Indianos com fendas, mas o genótipo 820GG contribuiu apenas para um risco menor.30 Há poucos estudos de associação disponíveis para o SNP rs642961, mas os resultados foram inconsistentes. Foi observada associação significante entre rs642961 e FLNS/ P.26,31–34 Em contraste com os estudos acima mencionados, nenhuma associação foi relatada por vários estudos.29,35–37

Os estudos de associação do genoma inteiro, e seus estudos de replicação de seguimento estabeleceram o IRF6 como um dos genes candidatos para a patogênese da FLNS/ P.38 O polimorfismo analisado nesse estudo (rs2235375) está localizado no intron‐6 do IRF6. Este polimorfismo demonstrou uma associação positiva entre essa variante e FLNS/ P em várias populações, como a italiana,7 europeia‐americana,25 norueguesa,39 chilena,28 chinesa40 e brasileira.41

Conclusão

Em conclusão, os resultados do presente estudo indicam que o polimorfismo IRF6 rs2235375 está associado à FLNS/P em uma população do sul da Índia.

Conflitos de interesse

Os autores declaram não haver conflitos de interesse.

Agradecimentos

L.V.K.S. Bhaskar agradece ao Conselho Indiano de Pesquisa Média (Indian Council of Medical Research ‐ ICMR) pela ajuda financeira recebida, e ao Governo da Índia (Projeto Ref. n° 56/15/2007‐BMS e n° 45/3/2013‐Hum/BMS).

Referências
[1]
O. Britanova,M.J. Depew,M. Schwark,B.L. Thomas,I. Miletich,P. Sharpe
Satb2 haploinsufficiency phenocopies 2q32‐q33 deletions, whereas loss suggests a fundamental role in the coordination of jaw development
Am J Hum Genet, 79 (2006), pp. 668-678 http://dx.doi.org/10.1086/508214
[2]
J.W. Park,J. Cai,I. McIntosh,E.W. Jabs,M.D. Fallin,R. Ingersoll
High throughput SNP and expression analyses of candidate genes for non‐syndromic oral clefts
J Med Genet, 43 (2006), pp. 598-608 http://dx.doi.org/10.1136/jmg.2005.040162
[3]
B.J. Barnes,A.E. Field,P.M. Pitha-Rowe
Virus‐induced heterodimer formation between IRF‐5 and IRF‐7 modulates assembly of the IFNA enhanceosome in vivo and transcriptional activity of IFNA genes
J Biol Chem, 278 (2003), pp. 16630-16641 http://dx.doi.org/10.1074/jbc.M212609200
[4]
S. Kondo,B.C. Schutte,R.J. Richardson,B.C. Bjork,A.S. Knight,Y. Watanabe
Mutations in IRF6 cause Van der Woude and popliteal pterygium syndromes
Nat Genet, 32 (2002), pp. 285-289 http://dx.doi.org/10.1038/ng985
[5]
L.E. Richardson,G.K. Wakley,S.H. Franklin
A quantitative study of the equine soft palate using histomorphometry
[6]
M. Rizos,M.N. Spyropoulos
Van der Woude syndrome: a review. Cardinal signs, epidemiology, associated features, differential diagnosis, expressivity, genetic counselling and treatment
Eur J Orthod, 26 (2004), pp. 17-24
[7]
L. Scapoli,A. Palmieri,M. Martinelli,F. Pezzetti,P. Carinci,M. Tognon
Strong evidence of linkage disequilibrium between polymorphisms at the IRF6 locus and nonsyndromic cleft lip with or without cleft palate, in an Italian population
Am J Hum Genet, 76 (2005), pp. 180-183 http://dx.doi.org/10.1086/427344
[8]
A.R. Vieira,J.R. Avila,S. Daack-Hirsch,E. Dragan,T.M. Felix,F. Rahimov
Medical sequencing of candidate genes for nonsyndromic cleft lip and palate
[9]
E. Mangold,K.U. Ludwig,M.M. Nothen
Breakthroughs in the genetics of orofacial clefting
Trends Mol Med, 17 (2011), pp. 725-733 http://dx.doi.org/10.1016/j.molmed.2011.07.007
[10]
T.H. Beaty,J.C. Murray,M.L. Marazita,R.G. Munger,I. Ruczinski,J.B. Hetmanski
A genome‐wide association study of cleft lip with and without cleft palate identifies risk variants near MAFB and ABCA4
Nat Genet, 42 (2010), pp. 525-529 http://dx.doi.org/10.1038/ng.580
[11]
T.M. Zucchero,M.E. Cooper,B.S. Maher,S. Daack-Hirsch,B. Nepomuceno,L. Ribeiro
Interferon regulatory factor 6 (IRF6) gene variants and the risk of isolated cleft lip or palate
N Engl J Med, 351 (2004), pp. 769-780 http://dx.doi.org/10.1056/NEJMoa032909
[12]
V.B. Gurramkonda,J. Murthy,A.H. Syed,B.V. Lakkakula
Evidence of association between IRF6 polymorphisms and nonsyndromic oral clefts in South Indian population
Dentistry 3000, 1 (2013), pp. 5
[13]
J. Sambrook,D. Russell
Molecular cloning: a laboratory manual
Cold Spring Harbor Laboratory Press, (2001)
[14]
J. Cuenca,P. Aleza,L. Navarro,P. Ollitrault
Assignment of SNP allelic configuration in polyploids using competitive allele‐specific PCR: application to citrus triploid progeny
Ann Bot, 111 (2013), pp. 731-742 http://dx.doi.org/10.1093/aob/mct032
[15]
V.V. Didenko
DNA probes using fluorescence resonance energy transfer (FRET): designs and applications
Biotechniques, 31 (2001), pp. 1106-1116
1118, 1120‐1
[16]
R. Ceppellini,M. Siniscalco,C.A. Smith
The estimation of gene frequencies in a random‐mating population
Ann Hum Genet, 20 (1955), pp. 97-115
[17]
C.R. Ingraham,A. Kinoshita,S. Kondo,B. Yang,S. Sajan,K.J. Trout
Abnormal skin, limb and craniofacial morphogenesis in mice deficient for interferon regulatory factor 6 (Irf6)
Nat Genet, 38 (2006), pp. 1335-1340 http://dx.doi.org/10.1038/ng1903
[18]
X. Xu,J. Han,Y. Ito,P. Bringas Jr.,M.M. Urata,Y. Chai
Cell autonomous requirement for Tgfbr2 in the disappearance of medial edge epithelium during palatal fusion
[19]
R.J. Richardson,J. Dixon,R. Jiang,M.J. Dixon
Integration of IRF6 and Jagged2 signalling is essential for controlling palatal adhesion and fusion competence
Hum Mol Genet, 18 (2009), pp. 2632-2642 http://dx.doi.org/10.1093/hmg/ddp201
[20]
A.S. Knight,B.C. Schutte,R. Jiang,M.J. Dixon
Developmental expression analysis of the mouse and chick orthologues of IRF6: the gene mutated in Van der Woude syndrome
Dev Dyn, 235 (2006), pp. 1441-1447 http://dx.doi.org/10.1002/dvdy.20598
[21]
M. Wang,Y. Pan,Z. Zhang,L. Wang
Three polymorphisms in IRF6 and 8q24 are associated with nonsyndromic cleft lip with or without cleft palate: evidence from 20 studies
Am J Med Genet A, 158A (2012), pp. 3080-3086 http://dx.doi.org/10.1002/ajmg.a.35634
[22]
W. Tang,X. Du,F. Feng,J. Long,Y. Lin,P. Li
Association analysis between the IRF6 G820A polymorphism and nonsyndromic cleft lip and/or cleft palate in a Chinese population
Cleft Palate Craniofac J, 46 (2009), pp. 89-92 http://dx.doi.org/10.1597/07-131.1
[23]
L. Scapoli,J. Marchesini,M. Martinelli,F. Pezzetti,F. Carinci,A. Palmieri
Study of folate receptor genes in nonsyndromic familial and sporadic cleft lip with or without cleft palate cases
Am J Med Genet A, 132A (2005), pp. 302-304 http://dx.doi.org/10.1002/ajmg.a.30469
[24]
M. Ghassibe,B. Bayet,N. Revencu,C. Verellen-Dumoulin,Y. Gillerot,R. Vanwijck
Interferon regulatory factor‐6: a gene predisposing to isolated cleft lip with or without cleft palate in the Belgian population
Eur J Hum Genet, 13 (2005), pp. 1239-1242 http://dx.doi.org/10.1038/sj.ejhg.5201486
[25]
S.H. Blanton,A. Cortez,S. Stal,J.B. Mulliken,R.H. Finnell,J.T. Hecht
Variation in IRF6 contributes to nonsyndromic cleft lip and palate
Am J Med Genet A, 137A (2005), pp. 259-262 http://dx.doi.org/10.1002/ajmg.a.30887
[26]
Q. Zhou,M. Li,W. Zhu,J. Guo,Y. Wang,Y. Li
Association between interferon regulatory factor 6 gene polymorphisms and nonsyndromic cleft lip with or without cleft palate in a chinese population
Cleft Palate Craniofac J, 50 (2013), pp. 570-576 http://dx.doi.org/10.1597/12-234
[27]
R. Hering,K. Grundmann
The IRF6 p.274V polymorphism is not a risk factor for isolated cleft lip
[author reply 09–10]
[28]
J. Suazo,J.L. Santos,L. Jara,R. Blanco
Linkage disequilibrium between IRF6 variants and nonsyndromic cleft lip/palate in the Chilean population
Am J Med Genet A, 146A (2008), pp. 2706-2708 http://dx.doi.org/10.1002/ajmg.a.32494
[29]
L.M. Paranaiba,A. Bufalino,H. Martelli-Junior,L.M. de Barros,E. Graner,R.D. Coletta
Lack of association between IRF6 polymorphisms (rs2235371 and rs642961) and non‐syndromic cleft lip and/or palate in a Brazilian population
[30]
V.B. Gurramkonda,J. Murthy,A.H. Syed,B.V. Lakkakula
Lack of association between IRF6 polymorphisms and nonsyndromic oral clefts in South Indian population
Dentistry 3000, 1 (2013), pp. 5
[31]
S. Birnbaum,K.U. Ludwig,H. Reutter,S. Herms,M. Steffens,M. Rubini
Key susceptibility locus for nonsyndromic cleft lip with or without cleft palate on chromosome 8q24
Nat Genet, 41 (2009), pp. 473-477 http://dx.doi.org/10.1038/ng.333
[32]
J. Shi,T. Song,X. Jiao,C. Qin,J. Zhou
Single‐nucleotide polymorphisms (SNPs) of the IRF6 and TFAP2A in non‐syndromic cleft lip with or without cleft palate (NSCLP) in a northern Chinese population
Biochem Biophys Res Commun, 410 (2011), pp. 732-736 http://dx.doi.org/10.1016/j.bbrc.2011.06.006
[33]
Y. Pan,J. Ma,W. Zhang,Y. Du,Y. Niu,M. Wang
IRF6 polymorphisms are associated with nonsyndromic orofacial clefts in a Chinese Han population
Am J Med Genet A, 152A (2010), pp. 2505-2511 http://dx.doi.org/10.1002/ajmg.a.33624
[34]
A. Mostowska,K.K. Hozyasz,P. Wojcicki,B. Biedziak,P. Paradowska,P.P. Jagodzinski
Association between genetic variants of reported candidate genes or regions and risk of cleft lip with or without cleft palate in the polish population
Birth Defects Res A Clin Mol Teratol, 88 (2010), pp. 538-545 http://dx.doi.org/10.1002/bdra.20687
[35]
Y.C. Larrabee,A.C. Birkeland,D.T. Kent,C. Flores,G.H. Su,J.H. Lee
Association of common variants, not rare mutations, in IRF6 with nonsyndromic clefts in a Honduran population
Laryngoscope, 121 (2011), pp. 1756-1759 http://dx.doi.org/10.1002/lary.21870
[36]
M. Pegelow,H. Koillinen,M. Magnusson,I. Fransson,P. Unneberg,J. Kere
Association and mutation analyses of the IRF6 gene in families with nonsyndromic and syndromic cleft lip and/or cleft palate
Cleft Palate Craniofac J, 51 (2014), pp. 49-55 http://dx.doi.org/10.1597/11-220
[37]
L.A. Brito,C.F. Bassi,C. Masotti,C. Malcher,K.M. Rocha,D. Schlesinger
IRF6 is a risk factor for nonsyndromic cleft lip in the Brazilian population
Am J Med Genet A, 158A (2012), pp. 2170-2175 http://dx.doi.org/10.1002/ajmg.a.35526
[38]
T.H. Beaty,M.A. Taub,A.F. Scott,J.C. Murray,M.L. Marazita,H. Schwender
Confirming genes influencing risk to cleft lip with/without cleft palate in a case‐parent trio study
Hum Genet, 132 (2013), pp. 771-781 http://dx.doi.org/10.1007/s00439-013-1283-6
[39]
A. Jugessur,F. Rahimov,R.T. Lie,A.J. Wilcox,H.K. Gjessing,R.M. Nilsen
Genetic variants in IRF6 and the risk of facial clefts: single‐marker and haplotype‐based analyses in a population‐based case‐control study of facial clefts in Norway
Genet Epidemiol, 32 (2008), pp. 413-424 http://dx.doi.org/10.1002/gepi.20314
[40]
Y. Huang,J. Wu,J. Ma,T.H. Beaty,J.W. Sull,L. Zhu
Association between IRF6 SNPs and oral clefts in West China
J Dent Res, 88 (2009), pp. 715-718 http://dx.doi.org/10.1177/0022034509341040
[41]
A. Ibarra-Arce,M. Garcia-Alvarez,D. Cortes-Gonzalez,G. Ortiz de Zarate-Alarcon,L. Flores-Pena,S. Sanchez-Camacho
IRF6 polymorphisms in Mexican patients with non‐syndromic cleft lip

Como citar este artigo: Gurramkonda VB, Syed AH, Murthy J, Lakkakula BV. IRF6 rs2235375 single nucleotide polymorphism is associated with isolated non‐syndromic cleft palate but not with cleft lip with or without palate in South Indian population. Braz J Otorhinolaryngol. 2018;84:473–7.

A revisão por pares é da responsabilidade da Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico‐Facial.

Copyright © 2017. Associação Brasileira de Otorrinolaringologia e Cirurgia Cérvico-Facial
Idiomas
Brazilian Journal of Otorhinolaryngology

Inscreva-se a Newsletter

Opções de artigo
Ferramentas
Política de cookies
Utilizamos cookies próprios e de terceiros para melhorar nossos serviços e mostrar publicidade relacionada às suas preferências, analisando seus hábitos de navegação. Se continuar a navegar, consideramos que aceita o seu uso. Você pode alterar a configuração ou obter mais informações aquí.